Treponema pallidum tprII subfamily genes internal fragments sequencing

Cover Page

Abstract

Background. The modern system of molecular typing of the Russian population of T. pallidum makes it possible to obtain results with a significant dominance of the 14d/f type, which determines the need to increase the differentiating ability of the applied methods of molecular typing of T. pallidum.

Aim. Identification and analysis of nucleotide sequence variability of internal gene fragments of the tprII family of Russian T. pallidum subsp. pallidum strains.

Material and methods. The study of internal variable fragments of genes of the tprII family was carried out among 240 clinical isolates of T. pallidum obtained from the Central (Kaluga Region, Moscow), North Caucasian (Stavropol Territory), Far East (Republic of Sakha), Volga (Chuvash Republic), Southern (Astrakhan Region) and Siberian (Novosibirsk and Omsk Regions, Republic of Tyva) federal districts in 2014–2020. The sequence of internal variable fragments of genes of the tprII family was determined using capillary sequencialng technology.

Results. The primers allowing both direct amplification of the internal variable region of the tprII genes subfamily and correct sequencing of their internal regions have been proposed. It was found one SNP at positions 1340 of tprG gene. The polymorphism differs the reference Nichols strain from globally distributed Street 14 genogroup variants.

Conclusion. The variability of tprII subfamily genes nucleotide sequences in modern Russian strains of T. pallidum subsp. pallidum is an additional fund to increase the efficiency of the modern T. pallidum molecular typing system.

 

Full Text

Введение

Молекулярная эпидемиология микроорганизмов представляет собой область знаний, позволяющую с использованием инструментов молекулярной медицины получать информацию не только о генетических особенностях микроорганизмов и их распространении, но и о генетической вариабельности, с выявлением подтипов, что важно с точки зрения оценки эпидемиологических свойств микроорганизмов, изучения их вирулентности и чувствительности к применяемым препаратам. Молекулярная идентификация и характеристика микроорганизмов особенно востребованы и в первую очередь актуальны в изучении труднокультивируемых или некультивируемых патогенов человека [1, 2].

Инфекции, передаваемые половым путем, являясь социально значимыми инфекционными заболеваниями, требуют внимательного эпидемиологического надзора за распространением, наряду с контролем и мониторингом изменчивости как генетической, так и филогенетической, влияющей на патогенные свойства и чувствительность к применяемым препаратам. Международные данные свидетельствуют о росте заболеваемости сифилисом в последние два десятилетия в ряде стран, в том числе с высоким уровнем доходов [3, 4]. Возбудитель сифилиса Treponema pallidum остается одним из самых трудных для изучения возбудителем инфекций человека — как классическими микробиологическими методами, ввиду невозможности культивирования in vitro, так и молекулярными методами, ввиду высокой консервативности генов и малых размеров генома.

После расшифровки в 1998 г. полного генома возбудителя сифилиса [5] и сравнения с другими представителями рода Treponema и вида T. pallidum [6, 7] методы генотипирования, основанные на детекции изменений в вариабельных участках генома, стали перспективными и получили развитие. Молекулярное типирование T. pallidum в первую очередь сфокусировано на изучении эпидемиологии за счет получения данных о распространенности тех или иных субтипов. Интересным и многообещающим является поиск молекулярных особенностей, связанных с устойчивостью к противомикробным препаратам, а также с развитием различных клинических форм, в том числе поздних, таких как нейросифилис. Однако имеющиеся данные противоречивы, и исследователи считают необходимым совершенствование методов молекулярного типирования для получения детальной информации о молекулярных субтипах T. pallidum [8].

Основанный на анализе гена arp (acidic repeat protein; tp0433) и генов подсемейства tprII (Treponema pallidum repeat) подход к молекулярному типированию T. pallidum subsp. pallidum предложен в 1998 г., затем утвержден Центром по контролю за заболеваниями (CDC, США) и получил название CDC-типирование (CDC typing, CDCT) [9–11]. При анализе гена arp, включенном в процедуру CDC-типирования, определяют количество 60 нуклеотидных повторов. Наличие консервативных фланкирующих участков генов подсемейства tprII, а также находящихся внутри них вариабельных фрагментов, составляющих в генах tprE, tprG и tprJ 800, 389 и 395 п.о. соответственно, являются свойствами, используемыми в процедуре типирования T. pallidum. Анализ генов подсемейства tprII (tprE (tp0313), tprG (tp0317), tprJ (tp0621)) представляет собой определение повторов и картины полиморфизма длин фрагментов рестрикции [9–11] путем амплификации соответствующего участка каждого из генов подсемейства tprII, эндонуклеазного картирования ампликонов рестриктазой MseI и последующего определения фрагментарной картины на основе электрофоретической подвижности фрагментов рестрикции в агарозном геле [11].

Идентифицируемому изоляту присваивается цифровой индекс, соответствующий количеству повторов в гене arp (от 2 до 22), дополненный буквенным обозначением, соответствующим определенному профилю полиморфизма длин фрагментов рестрикции продуктов амплификации генов tprII (16 вариантов). Наиболее распространенными типами в мире являются: 14d, 14f, 14a, 13d и 15d [12]. Молекулярный тип 14d признан самым распространенным в мире [4, 12].

В процессе многолетнего использования CDC-метода показано, что его дискриминирующие способности не всегда отражают объективную картину разнообразия генотипа T. pallidum subsp. pallidum, а эффективность метода, по данным литературы, составляет 68,2% [8], в частности, из-за выраженного преобладания вариантов с четырнадцатью повторами в гене arp [10, 11]. Исследователи в поисках способов повышения разрешающей способности метода в последующие годы предлагали пути усовершенствования метода типирования T. pallidum. Так, предложено секвенирование генов tp0136, tp0319, tp0548 и 23S рРНК [14], tp0705 [15] и анализ повторов в гене rpsA (tp0279, CDC-rpsA) [16]. Наиболее эффективным оказалось предложение секвенировать вариабельный участок гена tp0548 (позиции 131–215) [17], что в последующем позволило разделить подтипы 14а и 14d на подгруппы. Модификация метода СDC-типирования, включающая секвенирование вариабельного участка гена tp0548, в настоящее время известна как «расширенный (enhanced)» метод типирования CDC — ECDCT (enhanced CDC-typing) [17] и демонстрирует эффективность 72,3%, повышая эффективность типирования по сравнению с изначальной методикой.

Исследования позволили определить наиболее распространенные генотипы в большинстве стран мира — это 14d/f, 14d/g, 14d/c [18]. При этом субтип 14d/f является наиболее распространенным в Китае, Японии и Перу, а субтип 14d/g является преобладающим в популяциях Италии, Канады и Австралии [8, 19].

Ранее показано, что секвенирование участка гена arp также повышает точность метода CDC, поскольку различный нуклеотидный состав повторов и их комбинации одного молекулярного по гену arp типа разделяют этот тип на несколько субтипов [20].

В то же время анализ генов подсемейства tprII также свидетельствует о наличии скрытых резервов увеличения дифференцирующего потенциала метода, до сих пор основывающегося на полиморфизме длин фрагментов рестрикции. Основанием для этого является достаточно консервативное расположение сайтов рестрикции, локализующихся, как правило, во в значительной степени гомологичных фланкирующих областях и, как следствие, продуцирующих ограниченный набор вариантов картин рестрикции. Вместе с тем в настоящее время данные о вариабельности нуклеотидных последовательностей внутренних участков этих генов дают основания предполагать, что подобные локусы могли бы быть областью, повышающей дискриминирующую способность метода генотипирования T. pallidum subsp. рallidum. Секвенирование генов подсемейства tprII вместо рутинной детекции ПЦР-продуктов рестрикции его амплификатов представляется перспективным направлением совершенствования CDC-метода, приводящим молекулярное типирование T. pallidum subsp. pallidum к стандартам мультилокусного секвенирования бактериальных геномов.

В связи с вышеизложенным проведено настоящее исследование, целью которого является идентификация и анализ вариабельности нуклеотидных последовательностей внутренних фрагментов генов подсемейства tprII современных российских штаммов T. pallidum subsp. pallidum с использованием технологии капиллярного секвенирования.

Материал и методы

В ФГБУ «ГНЦДК» Минздрава России проведено исследование 240 клинических изолятов, полученных в 2014–2020 гг. из специализированных медицинских учреждений дерматовенерологического профиля Центрального (Калужская область, г. Москва), Северо-Кавказского (Ставропольский край), Дальневосточного (Республика Саха), Приволжского (Чувашская Республика), Южного (Астраханская область) и Сибирского (Новосибирская и Омская области, Республика Тыва) федеральных округов.

В связи с тем, что наиболее подходящим клиническим материалом для молекулярных исследований T. pallidum остаются образцы, полученные из элементов кожной сыпи пациентов с манифестными формами сифилиса, а использование образцов крови требует дальнейшей валидизации и не дает необходимого разнообразия субтипов [8], в данном исследовании для получения генетического материала T. pallidum использованы отделяемое шанкров и серозная жидкость эрозивных и язвенных элементов кожной сыпи, полученных от пациентов с клинически и лабораторно подтвержденными диагнозами «Первичный сифилис половых органов» (А51.1), «Первичный сифилис анальной области» (А51.1), «Первичный сифилис других локализаций» (А51.2) и «Вторичный сифилис кожи и слизистых оболочек» (А51.3).

В качестве референсного штамма использован штамм Nichols T. pallidum subsp. pallidum, культивируемый на тестикулярной модели у кроликов.

Методом ПЦР подтверждали присутствие ДНК T. pallidum subsp. pallidum в исследуемых образцах путем выявления целевого фрагмента (регион 1156–1531 п.о.) трепонемоспецифичной ДНК-полимеразы I polA [21] с использованием ДНК изолята, выделенной с помощью набора реагентов «Проба-НК» (ДНК-технология, Россия), в качестве матрицы.

Дальнейшее исследование клинических изолятов проводили в соответствии с расширенной CDC-методикой типирования (ECDCT), предложенной С. М. Marra [9], включая стартовую и гнездную амплификацию генов подсемейства tprII с последующей обработкой гнездового амплификата эндонуклеазой рестрикции Msel (НПО СибЭнзим, Россия), оценку электрофоретической подвижности полученных продуктов в агарозном геле относительно маркеров молекулярных масс GeneRuler 100 bp Plus DNA Ladder (Thermo Fisher Scientific Inc., США) и секвенирование вариабельного участка гена tp0548 [17].

Подбор праймеров для амплификации и секвенирования вариабельного фрагмента генов подсемейства tprII осуществлен путем подбора последовательностей, гомологичных 3’- и 5’-концам внутренних вариабельных фрагментов каждого из членов подсемейства и отсутствием гомологии на 3’-конце с последовательностями ДНК человека. Дополнительная верификация проведена с использованием online-сервиса подбора нуклеотидных последовательностей nucleotide BLAST Национального центра биотехнологической информации США [http://www.ncbi.nlm.nih.gov/]. Специфически амплифицировали внутренние фрагменты генов подсемейства tprII в следующих условиях: первоначальная денатурация: 95 °C, 5 мин; 40 циклов: 95 °C по 30 сек, 64 °C по 30 сек; 72 °C по 30 сек; финальная элонгация — 72 °C 3 мин.

Амплификация генов, очистка ПЦР-продукта после первого этапа амплификации и второй этап амплификации с применением меченых терминирующих нуклеотидов проводились в соответствии с описанными ранее методиками [22]. Переосажденные продукты полимеразной реакции с терминирующими нуклеотидами подвергнуты разделению капиллярным электрофорезом на приборе 3130 Genetic Analyzer (Applied Biosystems, США) с применением программного обеспечения 3130 Data Collection v.3.0.

Для первичной расшифровки нуклеотидных последовательностей вариабельного фрагмента генов подсемейства tprII использовано программное обеспечение Sequencing Analysis 5.3.1, а также Mega 5 с целью выравнивания генов подсемейства tprII на референсные последовательности T. pallidum subsp. pallidum.

Результаты

По результатам проведенного типирования 240 образцов T. pallidum по генам tprII в соответствии с процедурой CDC выделены молекулярные типы d, c, b, i, e.

В результате процедуры молекулярного типирования T. pallidum, включавшей анализ количества повторов в гене arp, анализ подсемейства генов tprII, а также установление последовательности вариабельного участка гена tp0548, что соответствует усовершенствованной схеме CDC, выборка разделена непропорционально на 9 молекулярных субтипов: 14d/f, 14b/f; 14d/g; 14с/f; 14i/f, 14e/f, 17d/f, 14b/g, 9/14d/f.

В проанализированной выборке установлен доминирующий молекулярный субтип 14d/f, к которому отнесено 92,9% всех исследованных образцов T. pallidum, а также 8 минорных субтипов, доля которых суммарно составила 7,1% выборки. Среди минорных субтипов чаще других определялся молекулярный субтип 14b/f — 2,5% выборки; также идентифицированы субтипы 14d/g и 14с/f — 1,7 и 0,8% соответственно; наиболее редкими молекулярными субтипами в исследованной выборке являлись14i/f, 14e/f, 17d/f, 14b/g, 9/14d/f — по 0,4% проанализированной выборки каждый. При этом среди исследованных образцов T. pallidum не выявлено ни одного образца, относящегося к субтипу а по генам подсемейства tprII, в то время как анализ контрольного референсного штамма Nichols T. pallidum подтвердил его принадлежность к молекулярному субтипу а.

Преобладание доминантного молекулярного типа может свидетельствовать о недостаточно точной дискриминации результатов типирования клинических изолятов в исследуемой выборке путем классического метода типирования. Тем самым полученный результат подтверждает необходимость совершенствования CDC-метода типирования. Особенностью генов подсемейства tprII, включенных в анализ по классической схеме типирования, является наличие идентичных нуклеотидных последовательностей в концевых областях и внутренних вариабельных участков (рис. 1). Одним из возможных способов дифференциации могли бы стать углубленное изучение и анализ последовательностей внутренних вариабельных участков генов подсемейства tprII с применением технологии капиллярного секвенирования. Предварительно проведенный анализ геномных последовательностей внутренних вариабельных фрагментов генов подсемейства tprII T. pallidum показал, что нуклеотидный состав в значительной степени вариабелен между генами tprE, tprG и tprJ [9]. Исследование отличий нуклеотидного состава и полиморфизмов генов tprE, tprG и tprJ может стать дополнением схемы типирования T. pallidum, позволяющим как достоверно отличить один молекулярный тип от другого, так и разделить мажоритарные типы на несколько субтипов с целью последующего установления характерных особенностей, возможной связи с детерминантами лекарственной устойчивости, а также отслеживания цепей передачи инфекции.

Технология такого дополнительного исследования остается до конца не разработанной. Поскольку использование предложенных A. Pillay с соавт. [9] прямого и обратного праймеров как на этапе первичной амплификации, так и в реакции гнездовой амплификации анализируемого участка ДНК не обеспечивает ни качественного выявления амплификата достоверного целевого размера, ни качественного прочтения нуклеотидных последовательностей в анализируемых внутренних вариабельных фрагментах генов подсемейства генов tprII, перевод решения этой задачи в практическую плоскость потребовал внесения изменений в протокол амплификации генов подсемейства tprII.

В связи с этим нами предложена процедура амплификации внутренних вариабельных фрагментов генов подсемейства tprII с использованием трех пар прямого и обратного праймеров (по одной для каждого из генов подсемейства: tprE, tprG и tprJ). При этом их использование ориентировано на получение целевых ампликонов размерами 719, 622 и 602 п.о., расположенных в генах tprE, tprG и tprJ между нуклеотидами 330037 и 330755, 334813 и 334192, 675823 и 675222 соответственно, в геноме штамма Nichols T. pallidum subsp. pallidum (№ CP004010.2 в базе данных https://www.ncbi.nlm.nih.gov).

Рис. 1. Последовательность внутренних вариабельных областей генов подсемейства tprII T. pallidum Примечание. Темно-серым цветом выделены внешние гомологичные области, а светло-серым внутренние; последовательности, выбранные в качестве олигонуклеотидов, подчеркнуты.

Fig. 1. Sequence of the T. pallidum tprII gene subfamily internal variable regions
Note. The outer homologous regions are dark-grey highlighted, the inner homologous regions are light-grey highlighted; sequences selected as oligonucleotides are underlined.

В процессе оптимизации выбраны только те амплифицирующие праймеры, которые комплементарны внутренней области, специфичны для каждого из генов и не имели значительной гомологии на 3’-конце с последовательностями из генома человека. Окончательный выбор остановлен на шести праймерах (табл.), два из которых хотя и были общими для tprG и tprJ, специфически амплифицировали внутренние фрагменты генов подсемейства tprII в следующих условиях: первоначальная денатурация: 95 °C, 5 мин; 40 циклов: 95 °C по 30 сек, 64 °C по 30 сек; 72 °C по 30 сек; финальная элонгация — 72 °C 3 мин.

В качестве матричной ДНК первоначально выбран гнездовой амплификат IP6-IP7 согласно методике типирования по классической схеме CDC [7]. Показано, что при выбранных условиях амплификация происходит не только из амплификата IP6-IP7, но и непосредственно из геномной ДНК T. pallidum subsp. pallidum (рис. 2). Установлено, что выбранные праймеры обеспечивают качественную амплификацию фрагментов с ожидаемыми размерами.

Ввиду того, что в результате ПЦР амплификаты были практически свободны от фрагментов нецелевого размера, принято решение об использовании амплифицирующих праймеров на этапе секвенирования. Подобный подход обеспечил качественное прочтение внутренних вариабельных участков генов подсемейства tprII, в результате чего определен нуклеотидный состав в конкретных молекулярных субтипах и выявлены нуклеотидные полиморфизмы.

Для выявления характерных особенностей различных молекулярных типов, когда-либо встречавшихся на территории Российской Федерации, амплифицированы внутренние вариабельные фрагменты 8 минорных молекулярных типов — всего 17 образцов T. pallidum (14b/f — 6 шт., 14d/g — 4 шт., 14с/f — 2 шт., 14i/f, 14e/f, 17d/f, 14b/g, 9/14d/f — по 1 шт.) и 1 изолят референсного штамма Nichols. В целях выявления мутаций внутри одного молекулярного типа амплифицированы внутренние вариабельные фрагменты 48 различных изолятов доминирующего в российской популяции молекулярного типа 14d/f.

Рис. 2. Электрофореграмма продуктов амплификации генов tprE, tprG, tprJ T. pallidum Примечание. М — маркер молекулярных масс; 622, 602, 719 —предполагаемый размер фрагментов.

Fig. 2. Electropherogram of the T. pallidum tprE, tprG, tprJ genes amplification products
Note. M — molecular weight marker; 622, 602, 719 estimated size of the fragments

По результатам проведенного исследования, анализированные последовательности внутренних вариабельных фрагментов генов tprE, tprG и tprJ 17 образцов генетического материала T. pallidum, отнесенных по генам подсемейства tprII к молекулярным субтипам 14b/f, 14d/g, 14с/f, 14i/f, 14e/f, 17d/f, 14b/g, 9/14d/f, сохраняли 100% гомологичную структуру между собой. Анализ нуклеотидных последовательностей 48 различных изолятов доминирующего в российской популяции молекулярного типа 14d/f также показал полную гомологию всех изолятов как между собой, так и с другими молекулярными типами из экспериментальной выборки.

Таблица. Последовательности праймеров, использованных для прямой амплификации и секвенирования фрагментов генов tprE, tprG, tprJ подсемейства tprII T. pallidum

Table. Sequences of primers used for T. pallidum tprE, tprG, tprJ genes fragments tprII subfamily direct amplification and sequencing

 

Название

Последовательность 5’-3’

Длина ПЦР-продукта (п.о.)

TPR_E for

GAGGACCGAAAGGACACGCGA

719

TPR_E rev

CAAACGTGGGAACGAACAACGA

TPR_G for

TAACGGCAGCCACCGAAACC

622

TPR_G rev

TACAGACACACGGCGCTGACT

TPR_J for

GCGACGCAGACAGTAACGGC

602

TPR_J rev

CATGCAGACGCACGCAGGTT

В то же время последовательность внутренних вариабельных фрагментов анализируемых генов полностью соответствовала последовательности штамма Street 14 T. pallidum subsp. pallidum (№ CP004011.1 в базе данных https://www.ncbi.nlm.nih.gov) [7]. Тем самым соотнесение полученных данных с представлениями о существовании в глобальной популяции T. pallidum subsp. pallidum двух обособленных генетических кластеров, известными представителями которых являются штаммы Nichols (Dallas, Chicago B и др.) и Street 14 (SS 14 like group: Philadelphia-1, AZ 11 и др.), позволяет сделать заключение о принадлежности российских изолятов к штамму Street 14, так же как это показано для возбудителей сифилиса, циркулирующих в странах Восточной Европы, а также на Кубе [23, 12].

Все проанализированные современные российские клинические изоляты T. pallidum в анализируемой выборке неидентичны по нуклеотидному составу последовательностям референсного штамма Nichols.

В то же время результат анализа нуклеотидных последовательностей внутренних вариабельных участков генов подсемейства tprII референсного штамма Nichols полностью согласовывался с зарегистрированными данными (№ CP004010.2 в https://www.ncbi.nlm.nih.gov). Единственный полиморфизм, обнаруженный в штамме Nichols T. pallidum, относящемся к субтипу 14a/f, замена T/C в гене tprG в положении 334483 (CP004010.2). Эта мутация хотя и приводила к изменениям в аминокислотной последовательности белка в позиции 447, но, ввиду однотипности аминокислот (аланин у Nichols и валин в исследованных изолятах), не сказывалась на функциях tprG (рис. 3).

Отсутствие даже единичных полиморфизмов в исследованной выборке клинических изолятов дает основания говорить о высокой консервативности и, следовательно, об исключительной значимости этого региона для жизнеспособности T. pallidum.

Обсуждение

Современный, получивший международное распространение, CDC-метод типирования для анализа эпидемиологии сифилиса, включающий в себя исследование генов arp, tprII и tp0548, в настоящее время остается основным инструментом мониторинга глобальной и региональной эпидемиологии сифилиса [10, 11]. Однако длительный опыт использования данного метода свидетельствует о недостаточной его дискриминирующей способности. Ранее показано [20], что разнообразие молекулярных типов по гену arp не ограничивается количеством 60 нуклеотидных повторов в исследуемом фрагменте, а может быть расширено путем идентификации типов повторов, а также порядка их расположения в самом гене arp. Высокая частота встречаемости генов подсемейства tprII с полиморфизмом длин фрагментов рестрикции, характерным для варианта d, также позволяет предполагать, что разнообразие структуры генов подсемейства tprII (tprE, tprG и tprJ) не ограничивается изменениями, генерирующими новые сайты рестрикции, узнаваемые эндонуклеазой MseI.

Ранее в 2013 г. исследователи провели детальный анализ генов семейства tpr среди видов рода Treponema [24], в результате которого выявили в T. pallidum subsp. pallidum субгрупп Sea81-4 и Mexico A химерных генов tprGJ. Однако различий в структуре генов подсемейства tprII в субгруппах Nichols, Bal 3 и Street 14 установлено не было.

В настоящем исследовании сделана попытка не только разделения этих субгрупп, но и повышения эффективности генотипирования T. pallidum путем перехода от электрофоретической детекции полиморфизма длин фрагментов рестрикции ампликонов генов подсемейства tprII к секвенированию его внутреннего вариабельного участка, реализованная с использованием процедуры амплификации непосредственно из геномной ДНК. Предложены олигонуклеотиды, позволяющие проводить амплификацию внутренних участков генов непосредственно из ДНК изолята и обеспечивать корректное прочтение его нуклеотидной последовательности при секвенировании.

Рис. 3. Выровненные последовательности продуктов амплификации гена tprG разных изолятов T. pallidum Примечание. Рамкой выделена обнаруженная замена С/Т.

Fig. 3. Aligned sequences of the different T. pallidum isolates tprG gene amplification products
Note. The detected C/T replacement is highlighted in the frame.

В результате настоящего исследования генов подсемейства tprII установлены последовательности внутренних вариабельных фрагментов генов tprE, tprG и tprJ 8 различных молекулярных типов T. pallidum subsp. pallidum. Определены 100% гомология внутренних вариабельных фрагментов генов tprE, tprG и tprJ внутри одного молекулярного типа и высокая консервативность этих последовательностей между различными типами, а также выявлено, что российская выборка изолятов имеет 100% гомологичные последовательности.

Все проанализированные российские изоляты (n = 240) отнесены к распространенной в Европе геногруппе Street 14 [11], что подтверждает ее доминирование в Российской Федерации.

Заключение

Результаты проведенного исследования показали, что секвенирование или минисеквенирование гена tprG позволяют дифференцировать геногруппы T. pallidum, что определяет возможность их использования для повышения эффективности молекулярного типирования T. pallidum. Дальнейшему усовершенствованию дискриминирующей эффективности предложенного метода с возможностью характеризовать молекулярные варианты T. pallidum subsp. pallidum с более узкой дифференцировкой способствует расширение области исследования. В частности, перемещение исследований на 3’-концевую область гена — локализацию, характеризующуюся частыми мутациями, а также увеличение количества исследуемых клинических изолятов, полученных из субъектов Российской Федерации. Необходимо отметить, что внутренние вариабельные фрагменты обладают консервативной структурой, в отличие от 3’- и 5’-фланкирующих областей, в которых происходят основные мутации, характеризующие те или иные молекулярные типы путем генерации или элиминации MseI сайтов.

Таким образом, вариабельность нуклеотидных последовательностей генов подсемейства tprII исследованных российских штаммов T. pallidum subsp. pallidum является одним из резервов для повышения эффективности современной системы молекулярного типирования T. pallidum. Продолжение исследований, основанных на секвенировании внутренних вариабельных фрагментов генов подсемейства tprII Treponema pallidum, является одним из путей усовершенствования системы молекулярного типирования возбудителя сифилиса, необходимой для проведения эпидемиологических исследований на современном уровне и осуществления мониторинга распространения сифилиса, основанного на отслеживании доминирующих и минорных субтипов T. pallidum

×

About the authors

Xenia I. Plakhova

State Research Center of Dermatovenereology and Cosmetology, Ministry of Health of the Russian Federation

Author for correspondence.
Email: plahova_xenia@mail.ru
ORCID iD: 0000-0003-4169-4128
SPIN-code: 7634-5521

Dr. Sci. (Biol.)

Russian Federation, Korolenko str., 3, bldg 6, Moscow, 107076, Russia

Alexander V. Chestkov

State Research Center of Dermatovenereology and Cosmetology, Ministry of Health of the Russian Federation

Email: chestkov@cnikvi.ru
ORCID iD: 0000-0003-0589-1263
SPIN-code: 6359-2366

Cand. Sci. (Biol.)

Russian Federation, Korolenko str., 3, bldg 6, Moscow, 107076, Russia

Nazerbek K. Abuduev

State Research Center of Dermatovenereology and Cosmetology, Ministry of Health of the Russian Federation

Email: ankor@mail.ru
ORCID iD: 0000-0002-6550-9348

Dr. Sci. (Biol.)

Russian Federation, Korolenko str., 3, bldg 6, Moscow, 107076, Russia

Michael M. Vasiliev

State Research Center of Dermatovenereology and Cosmetology, Ministry of Health of the Russian Federation

Email: ainfo@omxcourson.ru

Dr. Sci. (Biol.), Professor

Russian Federation, Korolenko str., 3, bldg 6, Moscow, 107076, Russia

References

  1. Akhtar A, Fuchs E, Mitchison T, et al. A decade of molecular cell biology: achievements and challenges. Nat Rev Mol Cell Biol. 2011 Sep 23;12(10):669–74. doi: 10.1038/nrm3187
  2. Dekker MC, van Duijn CM. Prospects of genetic epidemiology in the 21st century. Eur. J. Epidemiol. 2003;18(7):607–616.
  3. doi: 10.1023/A:1024933620315
  4. Burchell AN, Allen VG, Gardner SL, et al. T., 2015. High incidence of diagnosis with syphilis co-infection among men who have sex with men in an HIV cohort in Ontario, Canada. BMC Infect Dis. 2015 Aug 20;15:356. doi: 10.1186/s12879-015-1098-2
  5. Peterman TA, Su J, Bernstein KT, Weinstock H. Syphilis in the United States: on the rise? Expert Rev Anti Infect Ther. 2015;13:161–168. doi: 10.1586/14787210.2015.990384
  6. Fraser CM, Norris SJ, Weinstock GM, et al. Complete genome sequence of Treponema pallidum, the syphilis spirochete. Science. 1998 Jul 17;281(5375):375–88. doi: 10.1126/science.281.5375.375
  7. Dekker MC, van Duijn CM. Prospects of genetic epidemiology in the 21st century. Eur. J. Epidemiol. 2003;18(7):607–616.
  8. doi: 10.1023/a:1024933620315
  9. Matejkova P, Strouhal M, Smajs D, et al. Complete genome sequence of Treponema pallidum spp. pallidum strain SS14 determined with oligonucleotide arrays. BMC Microbiol, 2008;8:76.
  10. doi: 10.1186/1471-2180-8-76.
  11. Fu B, Li H, Zhao Y, et al. The comparison of molecular typing in Treponema pallidum: Review and meta-analysis. Infect Genet Evol. 2020 Mar;78:104049. doi: 10.1016/j.meegid.2019.104049
  12. Pillay A, Liu H, Chen CY, et al. Molecular subtyping of Treponema pallidum subspecies pallidum. Sex. Transm. Dis. 1998, 25(8):408–414.
  13. doi: 10.1097/00007435-199809000-00004
  14. Кубанов А.А., Воробьев Д.В., Обухов А.П., Образцова О.А., Дерябин Д.Г. Молекулярная эпидемиология Treponema pallidum в приграничном регионе Российской Федерации (Республика Тыва). Молекулярная генетика, микробиология и вирусология. 2017;1:30–34. [Kubanov AA, Vorob'ev DV, Obuhov AP, Obrazcova OA, Derjabin DG. Molekuljarnaja jepidemiologija Treponema pallidum v prigranichnom regione Rossijskoj Federacii (Respublika Tyva). Molekuljarnaja genetika, mikrobiologija i virusologija. 2017;1:30–34 (In Russ.)]
  15. Ma DY, Giacani L, Centurion-Lara A. The molecular epidemiology of Treponema pallidum subspecies pallidum. Sex Health. 2015, 12(2):141–147. doi: 10.1071/SH14197
  16. Grillová L, Angel A Noda, Lienhard R, et al. Multilocus Sequence Typing of Treponema pallidum subsp. pallidum in Cuba From 2012 to 2017J Infect Dis 2019 Mar 15; 219(7):1138–1145.
  17. doi: 10.1093/infdis/jiy604
  18. Сидоренко С.В., Соломка В.С., Кожушная О.С., Фриго Н.В. Методы типирования возбудителей инфекций, передаваемых половым путем. Вестник дерматологии и венерологии. 2010;3:12–21. [Sidorenko SV, Solomka VS, Kozhushnaja OS, Frigo NV. Metody tipirovanija vozbuditelej infekcij, peredavaemyh polovym putem. Vestnik dermatologii i venerologii. 2010;3:12–21 (In Russ.)]
  19. Cejkova D, Zobanikova M, Chen L, et al. Whole genome sequences of three Treponema pallidum ssp. pertenue strains: yaws and syphilis treponemes differ in less than 0.2% of the genome sequence. PLoS Negl. Trop. Dis. 2012, 6(1). doi: 10.1371/journal.pntd.0001471
  20. Grillova L, Bawa T, Mikalova L, et al. Molecular characterization of Treponema pallidum subsp. Journal Pre-proof 15 pallidum in Switzerland and France with a new multilocus sequence typing scheme. PLoS One 2018 30;13(7):e0200773 doi: 10.1371/journal.pone.0200773
  21. Katz KA, Pillay A, Ahrens K, et al. 2010. Molecular Epidemiology of Syphilis-San Francisco, 2004-2007. Sex. Transm. Dis. 2010;37(10):660–663. doi: 10.1097/OLQ.0b013e3181e1a77a
  22. Marra CM, Sahi SK, Tantalo LC, et al. Enhanced molecular typing of Treponema pallidum: geographical distribution of strain types and association with neurosyphilis. J. Infect. Dis. 2010; 202:1380–1388.
  23. doi: 10.1086/656533
  24. Ho EL, Lukehart SA. Syphilis: using modern approaches to understand an old disease. J. Clin. Invest. 2011:121(12):4584–4592.
  25. doi: 10.1172/JCI57173
  26. Peng R-R, Wang AL, Li J, et al. Molecular Typing of Treponema pallidum: A Systematic Review and Meta-Analysis. PLoS Negl Trop Dis 5(11): e1273. doi: 10.1371/journal.pntd.0001273
  27. Образцова О.А., Алейникова К.A., Кубанов А.А., Дерябин Д.Г. Вариабельность нуклеотидных последовательностей гена arp у российских изолятов Treponema pallidum. Журнал микробиологии, эпидемиологии и иммунобиологии. 2018:(3):45–52. [Obrazcova OA, Alejnikova KA, Kubanov AA, Derjabin DG. Variabel'nost' nukleotidnyh posledovatel'nostej gena arp u rossijskih izoljatov Treponema pallidum. Zhurnal mikrobiologii, jepidemiologii i immunobiologii. 2018:(3):45–52 (In Russ.)]
  28. Liu H, Rodes B, Chen CY, Steiner B. New tests for syphilis: rational design of a PCR method for detection of Treponema pallidum in clinical specimens using unique regions of the DNA polymerase I gene. J. Clin. Microbiol. 2001; 39(5):1941–1946. doi: 10.1128/JCM.39.5.1941-1946.2001
  29. Соломка В.С., Комягина Т.М., Честков А.В. и др. Молекулярное типирование и устойчивость к макролидным антибиотикам у российских клинических изолятов Treponema pallidum: данные 2018–2019 гг. Вестник дерматологии и венерологии. 2019;95(6):29–36. [Solomka VS, Komjagina TM, Chestkov AV, et al. Molekuljarnoe tipirovanie i ustojchivost' k makrolidnym antibiotikam u rossijskih klinicheskih izoljatov Treponema pallidum: dannye 2018–2019 gg. Vestnik dermatologii i venerologii. 2019;95(6):29–36 (In Russ.)]
  30. Flasarova M, Pospisilova P, Mikalova L, et al. Sequencing-based molecular typing of Treponema pallidum strains in the Czech Republic: all identified genotypes are related to the sequence of the SS14 strain. Acta Derm. Venereol. 2012;92:669–674. doi: 10.2340/00015555-1335.
  31. Centurion-Lara A, Giacani L, Godornes C, et al. Fine analysis of genetic diversity of the tpr gene family among treponemal species, subspecies and strains. PLoS Negl Trop Dis.2013 May 16;7(5):e2222.

Supplementary files

There are no supplementary files to display.

Statistics

Views

Abstract: 259

PDF (Russian): 78

Article Metrics

Metrics Loading ...

Dimensions

PlumX

Refbacks

  • There are currently no refbacks.

Copyright (c) 2021 Plakhova X.I., Chestkov A.V., Abuduev N.K., Vasiliev M.M.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies