Results of a study of genetic factors predisposing to the development of psoriasis among the population of the Russian Federation

Abstract


Goal. To assess the incidence of genes predisposing to the development of psoriasis based on selected molecular and genetic study methods among the Russian population. Materials and methods. By using allele specific hybridization methods in the form of real-time PCR and RFLP assay (Restriction Fragment Length Polymorphism), single-nucleotide polymorphisms of fragments of 13 genes associated with predisposition to the development of psoriasis were studied in whole blood samples obtained from 45 psoriatic patients: rs4649203 (gene IL-28RA), rs11209026 (gene IL-23R), rs610604 (gene TNFAIP3), rs514315 (gene SERPINB8), rs9304742 (gene ZNF816A), rs17728338 (gene TNIP1), rs13190932 (gene TRAF3IP2), rs2235617 (gene ZNF313), rs27524 (gene ERAP1), rs702873 (gene REL), rs3213094 (gene IL-12B), rs12720356 (gene TYK2), and rs8016947 (gene NFKBI). Results. A set of data on the genotype structure and incidence in respective loci of 13 genes associated with predisposition to develop psoriasis was obtained for the first time based on a Russian sample of patients. At this stage of the study, we failed to reveal any reliable differences concerning the incidence of individual genotypes between psoriatic patients and healthy people because of the small size of the sample. Gene TYK2 (rs1272035) served as an exclusion. The homozygous T/T genotype was revealed more often (p < 0.01) in psoriatic patients (95.6%) vs. healthy people (77.8%), which makes it possible to consider the carriers of this genotype as people predisposed to the development of psoriasis.

Full Text

Работа выполнена в рамках государственного задания Министерства здравоохранения Российской Федерации ФГБУ «Государственный научный центр дерматовенерологии и косметологии» на период 2012-2014 гг. Раздел I. Выполнение фундаментальных научных исследований. Наименование темы: «Изучение генетических факторов предрасположенности к развитию псориаза» по Государственному контракту 114/БУ-2012-051 от 16.01.2012 г.) Ш псориаз - воспалительное иммуноассоциирован-ное заболевание мультифакториальной природы с доминирующей ролью генетических факторов [1-3]. показатели заболеваемости населения псориазом в разных регионах мира варьируют от 0,6 до 5%, составляя в среднем 3% [4, 5]. В Российской Федерации заболеваемость псориазом, по данным официального государственного статистического учета, в 2010-2011 годах составила около 1% [4]. Эпидемиологические исследования, проведенные в XX веке, в ходе которых это заболевание изучалось в нескольких поколениях родственников, создали основу формирования генетической теории псориаза. В результате последующих работ было установлено значение генов, кодирующих белки главного комплекса гистосовместимости классов I и II, в развитии псориаза [6]. Широкомасштабные мультицентровые исследования, осуществляющиеся с начала XXI века по программе полногеномного анализа ассоциаций GWAS (Genome-wide association studies), направленные на выявление ассоциаций между генотипом и фенотипом человека, определили спектр различных генетических маркеров предрасположенности к псориазу; результаты этой работы представлены в базе данных Национального института здоровья США, доступной для исследователей в сети Интернет [7], и широко используются в качестве основы для молекулярногенетических исследований в различных регионах мира. В результате проведенных исследований была установлена роль в развитии псориаза одиночных нуклеотидных полиморфизмов (SNP), локализованных как в структуре генов главного комплекса гистосовместимости, так и в других регионах генома человека [8]. при этом изменение одного нуклеотида в молекуле ДНК оценивается как значимое, регистрируется в информационных базах данных и включается в эпидемиологические исследования, если частота его встречаемости в популяции превышает 1% [9]. К началу 2001 года в геноме человека было обнаружено более 1,5 миллиона SNP, информация о них также помещена в общедоступные базы данных [10], что создало возможность изучения генетической основы ряда мультифакториальных заболеваний в популяциях. Геномные исследования, осуществляемые по программе GWAS, проводятся с использованием специально разработанных биологических микрочипов высокой плотности (например, микрочипов формата Illumina Hap310K и Illumina Hap550K) [12], представляющих собой твердофазную подложку, на которой иммобилизованы изучаемые последовательности ДНК [15]. Высокая стоимость этого метода исследования и отсутствие репрезентативных ДНК-банков, основанных на получении, выделении и хранении образцов ДНК, полученных от больных мультифакториаль-ными заболеваниями, задерживает внедрение данной технологии в России. В связи с этим представляется рациональным изучение уже известных маркеров заболевания, в частности, выявленных методом GWAS, у больных псориазом в российской популяции. Следует отметить, что до настоящего времени в Российской Федерации крупных исследований по изучению частоты выявления представленных в международных базах данных генетических маркеров, ассоциированных с развитием псориаза, не проводилось; в научных публикациях имеются сообщения об идентификации лишь отдельных маркеров [11, 13-14]. В связи с вышеизложенным для выполнения настоящего исследования на основании анализа данных информационной базы GWAS нами были отобраны [27] гены, отвечающие за нарушение барьерной функции кожи, участвующие в реализации врожденного и адаптивного иммунитета, а также в презентации антигена (IL-28RA, IL-23R, TNFAIP3, SERPINB8, ZNF816A, TNIP1, TRAF3IP2, ZNF313, ERAP1, REL, IL-12B, NFKBI и TYK2), включающие одиночные нуклеотидные полиморфизмы, описанные в зарубежной литературе как маркеры заболевания. Роль этих полиморфизмов в развитии псориаза в российской популяции не изучена. Необходимым условием для выполнения проводимого крупномасштабного исследования по изучению распределения частот аллелей и генотипов маркеров локусов генов предрасположенности к развитию псориаза в российской популяции (планируемая популяционная выборка - не менее 500 больных псориазом и не менее 150 здоровых лиц) является определение методов, которые позволяют оптимально идентифицировать SNP. В связи с вышеизложенным целью настоящего исследования явилась оценка частоты встречаемости в российской популяции генов предрасположенности к псориазу выбранными методами молекулярногенетических исследований. Обоснование методологии изучения генетических факторов предрасположенности к развитию псориаза в российской популяции при выборе методологии определения SNP-маркеров были изучены известные современные методы определения SNP. Следует отметить, что ни один 80 к № 5, 2013 современный метод генотипирования не является универсальным, однако некоторые методы генотипирования доступны для осуществления многих исследовательских проектов [15]. Представленные ниже методы применяются в случаях, когда известны первичная последовательность анализируемого фрагмента ДНК, тип и локализация выявляемой однонуклеотидной замены. Обнаружить специфическую последовательность можно с помощью следующих основных методов ти-пирования SNP: 1) аллель-специфическая гибридизация (полимеразная цепная реакция (ПЦР) в реальном времени); 2) аллель-специфический рестрикционный анализ (полиморфизм длин рестрикционных фрагментов, ПДРФ-анализ); 3) аллель-специфическая достройка или удлинение праймера; 4) аллель-специфическое лигирование олигону-клеотидных фрагментов. Методы генотипирования включают стадии дискриминации аллелей1 генов и стадии детекции продуктов дискриминации. Во всех этих методах выявление маркеров обеспечивается за счет ферментов, обладающих способностью различать комплементарную и некомлементарную пару нуклеотидных оснований (мисматч) [16-19]. Все четыре метода надежны и применяются для решения различных задач. 1. Аллель-специфическая гибридизация (полимеразная цепная реакция в реальном времени, real-time PCR). Простейшим механизмом для генотипирования является аллель-специфическая гибридизация, основанная на разделении двух ДНК-мишеней (аллелей) в одном локусе гомологичных хромосом, несущих аллели изучаемого гена. Для ее проведения конструируются два аллель-специфических зонда с полиморфным основанием в центре нуклеотидной последовательности зонда. Стабильные гибридизованные зонды образуются при условии полной комплементарности оснований зонда и изучаемого образца. При несоответствии даже одной пары оснований гибридизация зонда является нестабильной (рис. 1) [28]. Основной задачей для обеспечения получения надежного результата при анализе аллельных дискриминаций является подбор оптимальных зондов. Этот механизм генотипирования реализуется в формате ПЦР в реальном времени. Реакционная смесь содержит пару праймеров для амплификации фрагмента исследуемого гена и два аллель-специфических зонда, меченных разными флуорофорами. В ходе ПЦР 5’-экзонуклеазная активность Taq-полимеразы разрушает зонд, что приводит к высвобождению флуо-рохрома и накоплению сигнала. Taq-полимераза разрушает зонды с высоким сродством к ПЦР-продукту. Таким образом, накопление сигнала происходит пропорционально эффективности гибридизации. Идентификация аллельных вариантов гена основана на различии эффективности гибридизации зонда в каждом цикле ПЦР с комплементарным зонду аллелем и некомплементарным аллелем (с заменой одного нуклеотида). Несмотря на то что различия эффективности G A Неспаривание Гибридизация Рис. 1. Аллель-специфическая гибридизация Гибридизация не происходит C A 1 Аллели - различные формы одного и того же гена, расположенные в одинаковых участках (локусах) гомологичных хромосом и определяющие альтернативные варианты развития одного и того же признака. Вестник дерматологии и венерологии Научные исследования л 81 гибридизации зондов незначительны, от цикла к циклу происходит накопление разницы в сигналах, полученных от двух зондов, что позволяет достоверно различать аллели и идентифицировать генотип в изучаемом SNP [20-21]. 2. Аллель-специфический рестрикционный анализ (анализ полиморфизма длины рестрикционных фрагментов (ПДРФ-анализ, RFLP - Restriction Fragment Length Polymorphism). ПДРФ-анализ основан на выявлении сайтов рестрикции2 геномной ДНК. Мутационная изменчивость ДНК в сайтах рестрикции может быть легко обнаружена по изменению длины рестрикционных фрагментов ДНК, гибридизующихся со специфическими ДНК-зондами. При наличии мутации в одном из сайтов рестрикции этот сайт остается нерасщепленным по сле завершения рестрикции, что приводит к слиянию соседних рестрикционных фрагментов ДНК, разделяемых мутантным сайтом, и образованию фрагмента ДНК большего размера. ПДРф-анализ включает этапы: выделение геномной ДНК, ее рестрикцию специфической эндонуклеазой, элекрофоретическое разделение образующихся фрагментов ДНК и идентификацию фрагментов ДНК, содержащих полиморфный сайт рестрикции, путем блот-гибридизации по Саузер-ну. Метод ПДРф широко используется в генетических исследованиях популяций, поскольку наличие в геноме исследуемого организма рестрикционного фрагмента ДНК определенной длины является прекрасным генетическим маркером и одновременно фенотипическим признаком, тесно связанным с генотипом организма (рис. 2) [25, 26]. Нормальная ДНК Мутантная ДНК EcoRI EcoRI 1 Т 5' GAATTC 3' 5' GAGTTC 3' 3' CTTAAG 5' 3' CTCAAG 5' EcoRI * EcoRI 1 Обработка 1 Обработка ▼ рестриктазой т рестриктазой 5' G + AATTC 3' 5' GAGTTC 3' 3' CTTAA G 5' 3' CTCAAG 5' 1 Электрофорез ДНК е л е СО К Н Д - - - я и а р S - 1 f EcoRI: - + - + J К J Норма Мутация | Рис. 2. Аллель-специфический рестрикционный анализ [24] 2 Сайт рестрикции - строго определенная последовательность нуклеотидов ДНК, узнаваемая и расщепляемая ферментами - рестрикта-зами. 82 к № 5, 2013 3. Аллель-специфическая достройка праймера, или удлинение праймера. Надежным механизмом аллельной дискриминации является удлинение праймера. Метод основан на способности ДНК-полимеразы включать в синтезируемую цепь дезоксирибонуклеотидтрифосфа-ты, комплементарные ДНК-матрице. Способы удлинения праймеров включают две основные группы. К первой относят процессы удлинения праймеров с помощью отдельных нуклеотидов (минисеквениро-вание), где полиморфное основание определяется за счет включения ДНК-полимеразой дидезоксину-клеотидтрифосфата, комплементарного полиморфному основанию матрицы. Способы, основанные на аллель-специфичном удлинении, при котором ДНК-полимераза работает лишь в случае полного соответствия праймера последовательности цепи, относят ко второй группе. В этом случае одновременно проводят две реакции ПЦР, в каждой из которых одним из праймеров служит аллель-специфическая мутантная олигонуклеотидная последовательность или олигонуклеотидная последовательность дикого типа соответственно. Данные олигонуклеотидные последовательности несут на 3’-конце соответствующие нуклеотиды (мутантный или дикого типа). В качестве второго праймера выступает одна и та же олигону-клеотидная последовательность, так чтобы в обеих реакциях ПЦР аплифицировались участки ДНК одинаковой длины. При определенных условиях и составе реакционной смеси наличие негомологичного спаривания на 3’-конце праймера препятствует синтезу ДНК (рис. 3). Таким образом, при наличии SNP-маркера в исследуемой матричной ДНК амплифицированные ПЦР-продукты образуются только в том случае, если в качестве аллель-специфического праймера выбирается мутантная олигонуклеотидная последовательность, тогда как с олигонуклеотидного праймера дикого типа ПЦР-реакция блокируется. Мониторинг произошедшего удлинения праймера позволяет сделать вывод о наличии искомого(ых) аллеля(ей) в образце ДНК. Данный механизм дискриминации аллелей реализуется методом ПЦР с последующей детекцией продуктов реакции с помощью электрофоретического разделения в агарозном геле либо с помощью капиллярного электрофореза (SNaPshot метод) [22], масс-спектрометрией, ДНК-микрочипами [23] и т. д. Однако метод является трудоемким, дорогостоящим и требует значительных затрат времени для оптимизации условий проведения реакций ПЦР [28]. Праймер 1 I Праймер 2 I Праймер 2 [ Праймер 1 I Нормальная ДНК А ■ А - ]т: С Общий праймер Амплификация Амплификация не идет Т Мутантная ДНК С Общий праймер Амплификация Амплификация не идет G Рис. 3. Аллель-специфическая достройка праймера [24] Вестник дерматологии и венерологии Научные исследования л 83 4. Аллель-специфическое лигирование олиго-нуклеотидных фрагментов. ДНК-лигаза является высокоспецифичным ферментом, который устраняет одноцепочечные разрывы в ДНК. Метод лигирования одноцепочечных разрывов основан на способности фермента ДНК-лигазы ковалентно сшивать расположенные друг за другом нуклеотиды. В процессе реализации метода используются три зонда, которые обеспечивают точное соединение двух прилегающих последовательностей целевой ДНК. Один зонд (основной) располагается с 5’-стороны от SNP. Два других зонда - ал-лель-специфические, меченые различными красителями, отличаются 3’-нуклеотидом, соответствующим позиции SNP [28]. Процесс исследования включает несколько циклов гибридизации, лигирования и денатурации. В ходе лигирования происходит сшивание основного и аллельного зондов. Полученные продукты лигирования детектируют в режиме реального времени или проводят электрофоретический анализ меченых однонитевых фрагментов ДНК [18]. Этот метод также является трудоемким, дорогостоящим и требует значительных затрат времени для подбора расходных материалов. На основании анализа преимуществ и недостатков приведенных молекулярных технологий в качестве метода исследования генетических факторов предрасположенности к развитию псориаза нами был выбран метод аллель-специфической гибридизации в формате ПЦР в реальном времени. Метод обеспечивает осуществление идентификации SNP, отличается высокой специфичностью, по сравнению с другими методами позволяет значительно ускорить процедуру анализа полиморфизмов на большой выборке обследуемых. Материалы и методы Материалы исследования Материалом для проведения экспериментальных исследований явились образцы цельной крови, полученные от больных псориазом (n = 45) и здоровых добровольцев (n = 45). Взятие образцов проводилось в вакуумные системы для забора крови типа Vacuette (BD Vacutainer, Великобритания) объемом 4 мл (пробирки с дозированным отрицательным давлением), в которых содержалась этилендиаминтетрауксусная кислота (ЭДТА) - стабилизатор свертывания крови, не ингибирующий ПЦР. До исследования образцы крови хранились в замороженном состоянии в морозильной камере, обеспечивающей постоянное поддержание температуры на уровне -20 оС. Перед началом исследования обеспечивали оттаивание образцов при комнатной температуре в течение 30 минут. Методология проведения исследования При разработке методологии проведения исследования для выявления частоты встречаемости SNP у больных псориазом и здоровых лиц был выбран метод аллель-специфической гибридизации в формате ПЦР в реальном времени. Исследование проводилось в несколько этапов: ■ выделение из образца геномной ДНК и оценка ее качества; ■ амплификация фрагментов генов и аллель-специ-фическая гибридизация мишеней и зондов в формате ПЦР в реальном времени. Выделение ДНК из образцов крови проводилось с использованием набора реагентов Diatom™ DNA Prep 100 (Biokom, Россия) в соответствии с инструкциями производителя. В состав указанного набора входит лизирующий реагент с гуанидинтиоционатом. Из рабочего раствора ДНК сорбировали на сорбенте С A- Р Р 84 к № 5, 2013 NucleoSTM, затем отмывали от белков и солей спиртовым раствором и элюировали буфером. Качество ДНК в пробах оценивалось с помощью электрофоретического разделения ДНК в 1% агарозном геле с последующим фотографированием гелей в ультрафиолетовом свете с длиной волны 310 нм с помощью встроенной в трансиллюминатор фотокамерой (Biorad, Германия). Очищенный раствор ДНК объемом 100 мкл помещался в микропробирки типа Eppendorf (Eppendorf, Германия) объемом 1,5 мл и хранился в условиях низкой температуры (-20 °С). Перед началом исследования с использованием программы Oligo6 производился подбор праймеров для амплификации фрагментов генов, включающих изучаемые полиморфизмы, а также подбор специфичных зондов, позволяющих идентифицировать соответствующие генотипы аллели в месте нахождения исследуемых SNP. Температура отжига праймеров и зондов в реакции подбиралась по формуле: 2*(А+Т) + 4*(G+C), где А и Т - количество адениновых и тимидиновых остатков в олигонуклеотиде, а G и С -количество гуаниновых и цитозиновых остатков. Перечень праймеров и зондов представлен в табл. 1. Амплификация каждого из фрагментов генов проводилась с использованием набора с HS Taq ДНК-полимеразой (Евроген) в соответствии с инструкцией Таблица 1 Праймеры и зонды для осуществления амплификации фрагментов генов и аллель-специфической гибридизации мишеней (SNP) и зондов в формате ПЦР в реальном времени Ген Однонуклеотидные полиморфизмы Праймеры (для амплификации фрагмента гена) Зонды (для идентификации полиморфизма гена) IL4/IL13 rs20541 20541for GTT CTACT CATGTGCTGA 20541rev ATCTGCAACTT CAATAGT C 20541A FAM-CGCGAGGGACAGTTCAAC-BHQ1 20541G Cy5-CGCGAGGGACGGTTCAAC-BHQ2 IL-28RA rs4649203 4649203for GCCTCTCTGGGTAGAAT 4649203rev CCAGGATGTTGAAGAGG 4649203G FAM-GCTGGGTTGCAGAGGAGG-BHQ1 4649203A Cy5-GCTGGATTGCAGAGGAGG-BHQ2 NFKBI rs8016947 8016947for TGAGAAAT CCTGCCACAT 8016947rev TGAGAGTTGGCTTCCTAA 8016947T FAM-GCAAACTTGTATTCTCCAGC-BHQ1 8016947G Cy5-GCAAACTTGTATTCTCCAGC-BHQ2 IL-23R rs11209026 11209026for CAACAGAGGAGACATTGGA 11209026rev GGCATGGGTAAGTACTTATT 11209026G FAM-GATCATTCCGAACTGGGTAG-BHQ1 11209026A Cy5-GATCATTCCGAACTGGGTAG-BHQ2 TNFAIP3 rs610604 610604for GGATGGACCAAGATTGATTA 610604rev CAT CATTAGCT CATAGAACAA 610604G FAM-GAAAAGTGTGAGCTCTTCATC-BHQ1 610604T Cy5-GAAAAGTGTTAGCT CTT CAT C-BHQ2 SERPINB8 rs514315 514315for ACATAGAAGTAGAATGGCT 514315rev GCTGAACATAATTAGGCAT 514315T Cy5-GGTTTTT CT CT CTT CT CACC-BHQ2 514315C FAM-GGII 1 1 1CTCCCTTCTCACC-BHQ1 ZNF816A rs9304742 9304742for CCAAAGTGCTAGGATTACA 9304742rev TATCTGGAGAGTTGGACAT 9304742 FAM-CCAACCAATGTGTTCGTAACA-BHQ1 9304742 Cy5-CCAACCAATGCGTTCGTAACA-BHQ2 HLA-C rs10484554 10484554for GACTTAACAT CAAGGTT CT 10484554rev GGTTGAGTTAAACT CTGTT 10484554 FAM-TCCTATCTCACCTATGACGTC -BHQ1 10484554 Cy5-T CCTAT CT CACTTATGACGTC-BHQ2 MIF rs755622 755622for TGACTTAGTGAAAGGACTA 755622rev AGTGGGGAAGTCACCGC 755622 FAM-GAGAACAGGTTGGAGCGGT-BHQ1 755622 Cy5-GAGAACAGCTTGGAGCGGT-BHQ2 TNIP1 rs17728338 17728338for T CATTAAGTGTAAACTGCAT 17728338rev CTATGCTCTGAGGACAAAT 17728338 FAM-TTAGTAGGACCGTTGCAAAAG-BHQ1 17728338 Cy5-TTAGTAGGACCATTGCAAAAG-BHQ2 TYK2 rs12720356 12720356for TTT CAACCCAGACCAAACT 12720356rev CACCATCTTCCAAGCCAT 12720356 FAM-TTACAGATATCATGGTGACAGA-BHQ1 12720356 Cy5-TTACAGATAGCATGGTGACAGA-BHQ2 TRAF3IP2 rs13190932 13190932for GAGGAATCAGAACCACC 13190932rev T CCAGAACTTGAGTGCG 13190932C FAM-AATCACCAGCGGCCTGTAT-BHQ1 13190932T Cy5-AAT CACCAGTGGCCTGTAT-BHQ2 IL-23A rs2066808 2066808for CTAGTT CCAGCT CTAATGA 2066808rev TCAGAAAAGTTAGGCCACT 2066808 FAM-CAAATGAAATCAGGAATGGTAGA-BHQ1 2066808 Cy5-CAAATGAAATCAGGAATGGTAGA-BHQ2 ZNF313 rs2235617 2235617for AACATTTGTAAAAAGGCTAG 2235617rev TATAAAAAT CCAATGCCCCA 2235617 FAM-GACTGCTTTCTCCTGTGCCT-BHQ1 2235617 Cy5-GACTGCTTTGTCCTGTGCCT-BHQ2 IL-28RA rs4649203 4649203for GCCTCTCTGGGTAGAAT 4649203rev CCAGGATGTTGAAGAGG 4649203G FAM-GCTGGGTTGCAGAGGAGG-BHQ1 4649203A Cy5-GCTGGATTGCAGAGGAGG-BHQ2 ERAP1 rs27524 27524 for CCTAGCATATGCATATATAA 27524rev GATGATAATGGACAGGTAAA 27524 FAM-CCTTTACAATAGCATAAAACATAC-BHQ1 27524 Cy5-CCTTTACAGTAGCATAAAACATAC-BHQ2 REL rs702873 702873for ATTAGGAAGATTAGTGGTGT 702873rev CTAAATAAGTCAAGGACCTA 702873FAM-TAGATGATGCGTACGTCTACC-BHQ1 702873 Cy5- TAGATGATGTGTACGT CTACC-BHQ2 IL-12B rs3213094 3213094rev AAGGCAGATACTGTTATTAT 3213094for AG CACAATTT CAGTTTCATA 3213094 FAM-CGAGAACAACGAACCAAGAC-BHQ1 3213094 Cy5-CGAGAACAATGAACCAAGAC-BHQ2 Вестник дерматологии и венерологии Научные исследования л 85 производителя с добавлением праймеров по 20 пмоль каждого, зондов по 10 пмоль и 200 нг ДНК человека, в формате 96-луночного планшета. пЦР фрагментов всех генов проводилась в режиме реального времени при разных условиях (табл. 2). при амплификации гена ERAP1 температура отжига составляла 54 °С, генов IL-23A, SERPINB8, TRAF3IP2 и IL-23R - 56 °С, генов TNFAIP3 и TNIP1 - 58 °С, гена REL - 60 °С и генов IL-28RA, zNF816A и zNF312 - 62 °С. Считывание сигнала флуоресценции с каналов детекции FAM и cy5 производили на стадии отжига праймеров (54 °С-62 °С); при этом программное обеспечение прибора представляло первичные данные в виде диаграммы распределения аллелей. О наличии в пробе одного или другого аллеля судили по отношению уровней флуоресценции от обоих зондов. программное обеспечение представляло результаты генотипирования в виде распределения аллелей. Аллели, меченные флуорофором cy5, обозначались зеленым цветом, аллели, меченные флуорофором FAM, - синим цветом, красным цветом обозначалась комбинация двух аллелей. На рисунке 5 представлено распределение аллелей гена TNFAIP3 (полиморфизм rs610604) у больных псориазом и здоровых добровольцев. Два SNP (полиморфизм rs8016947 в гене NFKBI и полиморфизм rs12720356 в гене TYK2) методом ал-лель-специфической гибридизации идентифицировать не удалось. Данное обстоятельство могло быть обусловлено сложной структурой нуклеотидной последовательности ДНК, окружающей данные SNP-маркеры, в связи с чем подобранные зонды работали неэффективно. поэтому для изучения полиморфизма rs8016947 в гене NFKBI и полиморфизма rs12720356 в гене TYK2 был применен метод анализа полиморфизма длины рестрикционных фрагментов (пДРф-анализ). Данные полиморфизмы входили в сайты рестрикции эндонуклеаз: Hinf1 (Сибэнзим, Россия) для исследования полиморфизма rs8016947 в гене NFKBI и EcoRV (Сибэнзим, Россия) для исследования полиморфизма rs12720356 в гене TYK2. протокол пДРф-анализа включал описанные выше этапы выделения ДНК из биообразцов крови, полученных от больных псориазом и здоровых добровольцев, и проведение методом пЦР амплификации фрагментов генов NFKBI и TYK2 с использованием ранее подобранных праймеров и условий проведения реакции. Дальнейшее исследование проводилось следующим образом. электрофоретическое разделение продуктов пЦР-реакции осуществлялось в 2% агарозном геле. Для приготовления 100 мл 2% агарозного геля 1 г агарозы смешивали с 10 мл 10 * TBE и 90 мл dH2O. приготовленную смесь прогревали в СВч-печи 5-7 мин. (до полного растворения агарозы), затем в нее добавляли 10 мкл бромистого этидия (1% раствор) и перемешивали. Расплавленную агарозу охлаждали до температуры 50-60 °С и заливали в планшет для заливки геля. Для получения в агарозном геле карманов для нанесения образцов на планшет устанавлиtiD laa we ни лш 4» шт чда *т дов зёвя кш Рис. 5. Диаграмма распределения аллелей гена TNFAIP3 (полиморфизм rs610604) у больных псориазом и здоровых добровольцев. "омозиготы А/А обозначены треугольниками зеленого цвета, гомозиготы С/С -треугольниками синего цвета, гетерозиготы А/С - треугольниками красного цвета | Таблица 2 Условия амплификации генов при проведении реакции амплификации Рекомендованные условия амплификации Количество циклов амплификации 95 °С - 7 мин. 1 цикл 95 °С - 10 сек. 40 циклов 54-62 °С - 1 мин. 72 °С - 1 сек. 86 к № 5, 2013 вали гребенки. Раствор агарозы застывал в течение 15-30 мин. при комнатной температуре. Результаты прохождения реакций амплификации оценивали с помощью трансиллюминатора с фотокамерой для фотографирования гелей в ультрафиолетовом свете с длиной волны 310 нм (Biorad, Германия). Дополнительно для проведения рестрикции продуктов амплификации ДНК использовались рестрик-тазы: ■ рестриктаза Hinf1 (Сибэнзим, Россия) для исследования полиморфизма rs8016947 в гене NFKBI; ■ рестриктаза EcoRV (Сибэнзим, Россия) для исследования полиморфизма rs12720356 в гене TYK2. Для проведения рестрикции готовили рестрикционную смесь, состав компонентов которой в расчете на одну пробирку приведен в табл. 3. После приготовления смесь компонентов аккуратно перемешивали и центрифугировали на аппарате Vortex (Биосан, Латвия). Затем в каждую микропробирку объемом 0,2 мл вносили 6 мкл приготовленной реакционной смеси для проведения рестрикции и 14 мкл продукта амплификации ДНК соответству ющего фрагмента. Общий объем реакционной смеси составлял 20 мкл. Рестрикция продуктов амплификации генов NFKBI и TYK2 проводилась в амплификаторе Dyad (Biorad, Германия). На первой стадии продукты амплификации подвергались обработке при температуре 37 °С в течение 120 мин. для осуществления рестрикции, а затем - обработке при 80 °С в течение 5 мин. для инактивации фермента. Результаты ПДРФ определялись визуально при анализе агарозного геля (рис. 6, 7) путем определения количества полученных фрагментов ДНК. При анализе полиморфизма rs12720356 в гене TYK2 полное расщепление ПЦР продукта указывало на гомозиготный генотип Т/Т данного гена; появление трех продуктов рестрикции указывало на гетерозиготный Т/G генотип данного гена. При анализе полиморфизма rs8016947 в гене NFKBI полное расщепление продукта ПЦР указывало генотип G/G; появление трех продуктов рестрикции указывало на гетерозиготный Т/G генотип данного гена, а появление одного продукта позволяло идентифицировать генотип Т/Т. Таблица 3 Состав реакционной смеси для проведения рестрикции продуктов амплификации генов NFKBI и TYK2 № Наименование реагента Объем, мкл 1 10 x буфер для рестриктазы 2 Рестриктаза dH2O Рис. 6. Результаты ПДРФ-анализа фрагмента гена TYK2. Дорожка 4 - маркер молекулярных весов 100 b.p (100-1000); дорожки 1, 2 и 3 - результаты рестрикции ДНК фрагмента гена TYK2 [дорожки 1 и 2 - генотип rs12720356 Т/Т (дикий тип), дорожка 3 -генотип rs12720356 Т/G Результаты ПДРФ-анализа фрагмента гена NFKBI. Дорожка 13 - маркер молекулярных весов 100 b.p (100-1000); дорожки 1-12 -Рис. 7. результаты рестрикции ДНК фрагмента гена NFKBI [дорожки 4 и 5 - генотип rs8016947 Т/Т (дикий тип), дорожки 2, 7, 9, 11 и 12 -генотип rs8016947 Т/G, дорожки 1, 3, 6, 8, и 10 - генотип rs8016947 G/G 3 Вестник дерматологии и венерологии Научные исследования л 87 Результаты исследования Результаты идентификации 11 полиморфизмов методом аллель-специфической гибридизации в формате ПЦР в реальном времени Методом аллель-специфической гибридизации в формате ПЦР в реальном времени на биоматериалах, полученных от 45 больных псориазом и 45 здоровых добровольцев, были установлены генотипы 11 из 13 изучавшихся маркеров предрасположенности к псориазу; установлена частота их встречаемости у больных псориазом и здоровых (табл. 4). Так, при изучении полиморфизма rs11209026 в гене IL-23R у подавляющего большинства обследованных был обнаружен генотип G/G: у 44 больных псориазом (80%) и у 41 здорового добровольца (74,5%). У 1 больного псориазом (2,2%) и у 2 здоровых (4,4%) был обнаружен генотип A/G. Генотип A/A у больных псориазом не был выявлен, но был обнаружен у 2 здоровых лиц (4,4%). В результате изучения методом аллель-специфи-ческой гибридизации полиморфизма rs4649203 гена IL-28RA у больных псориазом были обнаружены следующие генотипы: генотип AA - у 24 пациентов (53,3%), генотип GG - у 6 человек (13,3%) и генотип AG - у 15 (33,3%). У здоровых лиц данные генотипы встречались с частотой соответственно 57,8% (26/45), 8,9% (4/45) и 33,3% (15/45). Таблица 4 Частота встречаемости различных генотипов SNP генов IL-23R, IL-28RA, NFKBI, SERPINB8, TRAF3IP2, TNFAIP3, REL , ZNF313, IL-12B, TYK2, TNIP1, ZNF816A , ERAP1 у больных псориазом (n = 45) и здоровых добровольцев (n-45) Ген/ генотип Группы IL-23R (rs11209026) IL-28RA (rs4649203) NFKBI (rs8016947) AA GG AG AA GG AG GG TT GT Больные псориазом 0/45 0 44/45 80% 1/45 2,2% 24/45 53,3% 6/45 13,3% 15/45 33,3% 14/45 31,1% 5/45 11,1% 26/45 57,8% Контрольная группа 2/45 4,4% 41/45 74,5% 2/45 4,4% 26/45 57,8% 4/45 8,9% 15/45 33,3% 13/45 28,9% 8/45 17,8% 24/45 46,2% SERPINB8 (rs514315) TRAF3IP2 (rs13190932) TNFAIP3 (rs610604) СС TT CT AA GG AG АА СС АС Больные псориазом 7/45 15,6% 25/45 55,6% 13/45 28,9% 0/45 0 31/45 68,9% 14/45 31,1% 23/45 51,1% 4/45 8,9% 18/45 40,0% Контрольная группа 4/45 8,9% 22/45 48,9% 19/45 42,2% 0 0 33/45 73,3% 12/45 26,7% 26/45 57,8% 3/45 6,7% 16/45 35,6% REL (rs702873) ZNF313 (rs2235617) IL-12B (rs3213094) AA GG AG CG CC GG AA GG AG Больные псориазом 4/45 8,9% 22/45 48,9% 19/45 42,2% 18/45 40,0% 16/45 35,6% 11/45 24,4% 4/45 8,9% 26/45 57,8% 15/45 33,3% Контрольная группа 9/45 20,0% 16/45 35,6% 21/45 46,7% 20/45 44,4% 14/45 31,1% 11/45 24,4% 2/45 4,4% 25/45 55,6% 18/45 40,0% TYK2 (rs1272035) TNIP1 (rs17728338) ZNF816A (rs9304742) TT TG - GG AG AA CC CT TT Больные псориазом *43/45 95,6% *2/45 4,4% - 32/45 71,1% 13/45 28,9% 0/45 0 4/45 8,9% 17/45 37,8% 24/45 53,3% Контрольная группа 35/45 77,8% 10/45 22,2% - 40/45 88,9% 15/45 33,3% 0 6/45 13,3% 19/45 42,2% 20/45 44,4% ERAP1 (rs27524) GG AG AA Больные псориазом 18/45 40,0% 25/45 55,6% 2/45 4,4% Контрольная группа 19/45 42,2% 21/45 46,7% 5/45 11,1% Примечание: * Отличия между больными пориазом и здоровыми достоверны. 88 к № 5, 2013 Полиморфизм rs514315 гена SERPINB8 характеризовался следующими вариантами: наиболее часто встречался генотип Т/Т (у 25 больных псориазом (55,6%) и у 22 здоровых (48,9%)); гетерозиготный генотип С/Т был зарегистрирован у 13 больных псориазом (28,9%) и 19 здоровых добровольцев (42,2%); гомозиготный генотип С/С был отмечен у 7 больных псориазом (15,6%) и 4 здоровых (8,9%). При изучении полиморфизма rs13190932 гена TRAF3IP2 были выявлены генотипы A/G и G/G. Наиболее часто встречался генотип G/G: его частота у больных псориазом составила 68,9% (у 31 из 45 человек), у здоровых - 73,3% (у 33 из 45 человек). Вторым по частоте выявления был гетерозиготный генотип A/G: частота данного генотипа у больных псориазом составила 31,1% (у 14 из 45 человек), у здоровых соответственно 26,7% (у 12 из 45 человек). Полиморфизм rs610604 гена TNFAIP3 характеризовался следующими вариантами: А/А, С/С и А/С. Наиболее часто регистрировался генотип А/А: его частота у больных псориазом составила 51,1% (у 23 из 45 человек), у здоровых 57,8% (у 26 из 45 человек). Вторым по частоте встречаемости был генотип А/С, который регистрировался у 18 из 45 больных псориазом (40,0%) и у 16 из 45 здоровых (35,6%). При изучении полиморфизма rs702873 гена REL в выборке обследованных были выявлены генотипы A/A,G/G и A/G. При этом с близкой частотой, как у больных псориазом, так и у здоровых, встречались генотипы G/G и A/G: генотип G/G был зарегистрирован у 22 больных псориазом (48,9%) и у 16 здоровых лиц (35,6%); генотип A/G встречался у 19 больных псориазом (42,2%) и у 21 здорового добровольца (46,7%). Наиболее редким в выборке был генотип A/A, который был установлен у 4 больных псориазом (8,9%) и у 9 здоровых лиц (20,0%). При изучении полиморфизма rs2235617 в гене ZNF313 было установлено 3 варианта генотипов: C/C, G/G и C/G. При этом у больных псориазом и здоровых лиц генотипы встречались с близкой частотой: C/G - у 18 больных псориазом (40,0% ) и у 20 здоровых (44,4%); C/C - у 16 больных псориазом (35,6%) и у 14 здоровых (31,1%); генотип G/G - у 11 больных псориазом и у 11 здоровых (24,4%). Полиморфизм rs3213094 в гене IL-12B характеризовался следующими вариантами: А/А, G/G и A/G. Наиболее часто регистрировался генотип G/G, который был зарегистрирован у 26 больных псориазом (57,8%) и у 25 здоровых добровольцев (55,6%). На втором месте по частоте регистрации у обследованных был гетерозиготный генотип A/G, который встречался у 15 больных псориазом (33,3%) и у 18 здоровых лиц (40,0%). Генотип А/А был наиболее редким и идентифицировался у 4 больных псориазом (8,9%) и у 2 здоровых добровольцев (4,4%). В результате изучения полиморфизма rs17728338 в гене TNIP1 у обследованных были идентифицированы два вида генотипов: A/G и G/G. Гомозиготный генотип G/G встречался у 32 больных псориазом (71,1%) и у 40 здоровых (88,9%); гетерозиготный генотип A/G был зарегистрирован у 13 больных псориазом (28,9%) и у 15 здоровых лиц (33,3%). Полиморфизм rs9304742 гена ZNF816A характеризовался наличием трех генотипов: C/C, C/T T/T; при этом как у больных псориазом, так и у здоровых данные генотипы встречались с близкой частотой. Так, генотип C/C был зарегистрирован у 4 больных (8,9%) и у 6 здоровых (13,3%); генотип C/T регистрировался у 17 больных псориазом (37,8%) и у 19 здоровых (42,2%); генотип T/T встречался наиболее часто и был отмечен у 24 больных псориазом (53,3%) и у 20 здоровых (44,4%). В результате изучения полиморфизма rs27524 гена ERAP1 были идентифицированы генотипы А/А, G/G, A/G; при этом наиболее частым в выборке обследованных был гетерозиготный генотип A/G, который встречался у 25 больных псориазом (55,6%) и у 21 здорового добровольца (46,7%). На втором месте по частоте регистрации был гомозиготный генотип G/G; данный генотип был зарегистрирован у 18 больных псориазом (40,0%) и у 19 здоровых добровольцев (42,2%). Генотип А/А был зарегистрирован у 2 больных псориазом (4,4%) и у 5 здоровых добровольцев (11,1%). Результаты идентификации двух полиморфизмов (rs8016947 и rs12720356) методом ПДРФ В результате проведения ПДРФ-анализа в обследованной выборке пациентов были идентифицированы 2 полиморфизма: полиморфизм rs1272035 в гене TYK2 и полиморфизм rs8016947 в гене NFKBI. Полиморфизм rs1272035 в гене TYK2 характеризовался наличием двух генотипов: гомозиготного генотипа Т/Т и гетерозиготного генотипа Т/G. Гомозиготный генотип Т/Т встречался у 43 больных псориазом (95,6%) и у 35 здоровых лиц (77,8%). Гетерозиготный генотип Т/G был зарегистрирован у 2 больных псориазом (4,4%) и у 10 здоровых (22,2%). Полиморфизм rs8016947 в гене NFKBI был отмечен тремя генотипами: гомозиготными G/G и T/T и гетерозиготным - G/T. Генотип G/T в выборке обследованных встречался наиболее часто: у 26 больных псориазом (57,8%) и у 24 здоровых лиц (46,2%). Генотип G/G был вторым по частоте регистрации в выборке и обнаруживался у 14 больных псориазом (31,1%) и у 13 здоровых (28,9%). Генотип T/T был наиболее редким и выявлялся у 5 больных псориазом (11,1%) и у 8 здоровых (17,8%). Достоверных отличий между частотой встречаемости отдельных генотипов между больными псориазом и здоровыми на данном этапе исследования выявлено не было, что может быть объяснено относительной малочисленностью выборки. Исключение составил ген TYK2: rs1272035. Гомозиготный ге Вестник дерматологии и венерологии Научные исследования л 89 нотип Т/Т значительно чаще встречался у больных псориазом (95,6%) в сравнении со здоровыми лицами (77,8%) (OR = 6.1 ± 4.9; х2 = 6,0; р = 0,01), что позволяет рассматривать носителей данного генотипа как лиц с повышенной предрасположенностью к развитию псориаза, а сам генотип TYK2-T/G - как фактор риска в отношении развития псориаза. Напротив, гетерозиготный генотип Т/G значительно чаще встречался у здоровых (22,2%) в сравнении с больными псориазом (4,4%) (OR = 0,16 ± 0,13; X2 = 6,1; р = 0,01). Заключение Несмотря на множество разработанных и внедренных в последние годы методов генотипирования SNP, универсального метода для определения различных генетических маркеров заболевания не существует. С целью проведения генотипирования маркеров предрасположенности к развитию псориаза нами был выбран метод аллель-специфической гибридизации в формате ПЦР в реальном времени, обладающий преимуществами в сравнении с другими молекулярными методами, применяемыми для идентификации SNP: высокой специфичностью реакции за счет использования гибридизационных зондов, снижением риска контаминации за счет исключения постамплификационных манипуляций с продуктом амплификации, экономией времени и сокращением материальных затрат на выполнение исследований, возможностью автоматизации и стандартизации ПЦР в реальном времени. В результате применения метода аллель-специфи-ческой гибридизации в формате ПЦР в реальном времени у обследованных лиц (45 больных псориазом и 45 здоровых добровольцев) были установлены генотипы 11 из 13 изучавшихся маркеров предрасположенности к псориазу, описанных в зарубежной литературе как маркеры заболевания; установлена частота их встречаемости у больных псориазом и здоровых: (rs4649203 (ген IL-28RA), rs11209026 (ген IL-23R), rs610604 (ген TNFAIP3), rs514315 (ген SERPINB8), rs9304742 (ген ZNF816A), rs17728338 (ген TNIP1), rs13190932 (ген TRAF3IP2), rs2235617 (ген ZNF313), rs27524 (ген ERAP1), rs702873 (ген REL), rs3213094 (ген IL-12B). rs9304742. Генотип двух SNP (rs12720356 (ген TYK2), rs8016947 (ген NFKBI)) методом аллель-специфиче-ской гибридизации установить не удалось, что могло быть обусловлено сложной структурой нуклеотидной последовательности ДНК, окружающей данные SNP-маркеры, в связи с чем подобранные зонды работали неэффективно. Для изучения полиморфизмов фрагментов генов rs12720356 (ген TYK2), rs8016947 (ген NFKBI) протокол исследования был изменен: для изучения данных полиморфизмов был применен ПДРф-анализ, обладающий высокой точностью, воспроизводимостью, не требующий подбора аллель-специфических зондов и применения дорогостоящего оборудования. В результате проведенных работ впервые на российской выборке пациентов был получен массив экспериментальных данных о структуре и частоте встречаемости генотипов в соответствующих позициях 13 генов, ассоциированных с предрасположенностью к развитию псориаза. Полученные результаты подлежат подробному статистическому анализу на дальнейших этапах исследования при увеличении выборки больных псориазом не менее чем до 500 человек и выборки здоровых - не менее чем до 150 человек. На настоящем этапе исследования достоверных отличий между частотой встречаемости отдельных генотипов между больными псориазом и здоровыми выявлено не было, что может быть объяснено относительной малочисленностью выборки. Исключение составил ген TYK2: rs1272035. Гомозиготный генотип Т/Т значительно чаще встречался у больных псориазом (95,6%) в сравнении со здоровыми лицами (77,8%) (OR = 6.1 ± 4.9; х2 = 6,0; р = 0,01), что позволяет рассматривать носителей данного генотипа как лиц с повышенной предрасположенностью к развитию псориаза, а сам генотип TYK2-T/G - как фактор риска в отношении развития псориаза. Напротив, гетерозиготный генотип Т/G значительно чаще встречался у здоровых (22,2%) в сравнении с больными псориазом (4,4%) (OR = 0,16 ± 0,13; X2 = 6,1; р = 0,01). I

About the authors

A A MINEYEVA

State Research Center of Dermatovenereology and Cosmetology Ministry of Healthcare of the Russian Federation


O S KOZHUSHNAYA

State Research Center of Dermatovenereology and Cosmetology Ministry of Healthcare of the Russian Federation


L F ZNAMENSKAYA

State Research Center of Dermatovenereology and Cosmetology Ministry of Healthcare of the Russian Federation


V V CHIKIN

State Research Center of Dermatovenereology and Cosmetology Ministry of Healthcare of the Russian Federation

Email: chikin@cnikvi.ru

N V FRIGO

State Research Center of Dermatovenereology and Cosmetology Ministry of Healthcare of the Russian Federation


References

  1. Nestle F.O., Kaplan D.H., Barker. J. Psoriasis. N Engl J Med 2009; 361: 496-509.
  2. Elder J.T., Bruce A.T., Gudjonsson J.E. et al. Molecular dissection of psoriasis: integrating genetics and biology. J Invest Dermatol 2010; 130: 1213-1226.
  3. Федоров С.М. Псориаз: клинические и терапевтические аспекты. Рус. Мед. Журн. 2001; 9 (11): 447-451
  4. Знаменская Л.Ф., Мелехина Л.Е., Богданова Е.В., Минеева А.А. Заболеваемость и распространенность псориаза в Российской Федерации. Вестн дерматол. и венерол. 2012; 5: 20-29
  5. Gelfand J.M., Weinstein R., Porter S.B. et al. Prevalence and treatment of psoriasis in the United Kingdom: a population-based study. Arch Dermatol 2005; 141 (12): 1537-1541.
  6. Griffiths C.E., Barker J.N. Pathogenesis and clinical features of psoriasis. Lancet 2007; 370 (9583): 263-271.
  7. База данных Национального института здоровья США. http://www.genome.gov/gwastudies.
  8. Michailidis C., Karpouzis A., Kourmouli N. Notch2, notch4 gene polymorphisms in psoriasis vulgaris. Eur J Dermatol 2013; 23 (2): 146-153.
  9. Brookes, A.J. 1999. The essence of SNP. Gene 234: 177-186.
  10. Sachidanandam R, Weissman D, Schmidt SC et al. A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms. Cold Spring Harbor, New York 11724, USA
  11. Хайрутдинов В.Р., Пономарев И.А., Жуков А.С. и др. Новая генетическая детерминанта псориаза - Ile479Leu полиморфизм гена каспазы-10. Вестн дерматол и венерол 2009; 1: 12-14
  12. Баранов В.С. Полиморфизм генов, экогенетические болезни и предиктивная персонализированная медицина. Экологическая генетика. 2011; 9 (3): 3-14
  13. Каганова Н.Л., Фриго Н.В., Знаменская Л.Ф. и др. Возможность прогнозирования клинического ответа на лечение больных псориазом. Вестн дерматол и венерол 2009; 4: 20-26
  14. Терман О.А., Шульман А.Я., Кухарева Е.Н. Полиморфизм RAGE-гена у больных псориазом. Вестн дерматол и венерол 2006; 5: 62-65
  15. Kwok P-Y. Methods for genotyping singlenucleotide polymorphisms. Annu Rev Genomics Hum Genet 2001 (2): 235-258
  16. Friedman K.J., Highsmith W.E., Jr., Prior T.W. et al. Cystic fibrosis deletion mutation detected by PCR-mediated site-directed mutagenesis. Clin Chem 1990; 36: 695-696
  17. Kalinina O., Lebedeva I., Brown J. et al. Nanoliter scale PCR with TaqMan detection. Nucleic Acids Res 1997; 25: 1999-2004
  18. Barany F. Genetic disease detection and DNA amplification using cloned thermostable ligase. Proc Natl Acad Sci U S A 1991; 88: 189-193
  19. Кофиади И.А., Ребриков Д.В. Методы детекции однонуклеотидных полиморфизмов: аллель-специфичный ПЦРигибридизация с олигонуклеотидной пробой. Генетика 2007; 26: 22-32
  20. Happich D., Madlener K., Schwaab R. et al. Application of the TaqMan-PCR for genotyping of the prothrombin G20210A mutation and of the thermolabile methylenetetrahydrofolate reductase mutation. Thromb Haemost 2000; 84 (1): 144-145
  21. Holland P.M., Abramson R.D., Watson R. et al. Detection of specific polymerase chain reaction product by utilizing the 5'-3' exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci U S A 1991; 88 (16): 7276-7280.
  22. Bouakaze C., Keyser C., De Martino S.J. et al. Identification and genotyping of Mycobacterium tuberculosis complex species by use of a SNaPshot Minisequencingbased assay. J Clin Microbiol. 2010; 48 (5): 1758-1766. Sankowski A.J., Lebkowska U.M., Cwikla J. Psoriatic arthritis. Pol J Radiol. 2013 Jan-Mar; 78(1): 7-17.
  23. Choi S.Y., Lee K.Y., Kim Y.E. et al. Application of allelespecific primer extension-based microarray for simultaneous multi-gene mutation screening in patients with non-syndromic hearing loss. Int J Mol Med 2010; 25(3): 315-320.
  24. Klinicheskaya biokhimiya: uchebnoe posobie. 3-e izdanie / pod red. V.A. Tkachuka. M.: GEOTAR-Media, 2008. [Клиническая биохимия: учебное пособие. 3-е издание / под ред. В.А. Ткачука. М.: ГЭОТАР-Медиа, 2008.]
  25. Cooper D.N., Schmidtke J. DNA restriction fragment length polymorphisms and heterozygosity in the human genome. Hum Genet 1984; 66 (1): 1-16.
  26. Eiken H.G., Odland E., Boman H. et al. Application of natural and amplification created restriction sites for the diagnosis of PKU mutations. Nucleic Acids Res 1991; 19 (7): 1427-1430.
  27. Минеева А.А., Кожушная О.С., Волнухин В.А. и др. Изучение генетических факторов предрасположенности к развитию псориаза. Вестн дерматол и венерол 2012; 3: 30-38
  28. Borodina T. Metody detektsii SNP Institut Biologii Gena. [Бородина Т. «Методы детекции SNP» Институт Биологии Гена]. http://molbiol.edu.ru/review/04_03.html

Statistics

Views

Abstract - 658

PDF (Russian) - 424

PlumX

Article Metrics

Metrics Loading ...

Dimensions

Refbacks

  • There are currently no refbacks.

Copyright (c) 2013 MINEYEVA A.A., KOZHUSHNAYA O.S., ZNAMENSKAYA L.F., CHIKIN V.V., FRIGO N.V.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies