First experience of molecular typing and determining the antibiotic resistance of syphilis pathogen Treponema pallidum in the Russian Federation

Abstract


The authors present the results of molecular typing and determining the antibiotic resistance of 190 T. pallidum strains sampled from primary and secondary syphilitic patients in the russian Federation in 2011—2012. molecular typing of T. pallidum strains was based on two variable gens: arp, tpr, and was supplemented with an analysis of gene tp0548 reading frame. Antibiotic resistance of syphilis strains was determined by means of sequencing the gene encoding 23S rRNA T. pallidum in such loci as A2058G and A2059G/C (resistance to macrolides), gene encoding 16S rRNA T. pallidum in locus G1058C, and determinant tetB (resistance to tetracyclines) as well as full-scale sequencing the genes encoding target proteins of β-lactams Tp47 and Tromp. As a result of molecular typing in the territory of the Russian Federation, ten subtypes of T. pallidum were revealed. Type 14 (98.4%) predominates; the share of subtype 14d/f is 91.03%; the share of subtypes 14d/Tand 14b/f, Type 14, was 2.10 and 3.16%, respectively; the share of all other subtypes (11d/f, 13d/f, 14a/a, 14a/f, 14d/g, 14d/c, 20d/f) was 0.53%. molecular markers of T. pallidum antibiotic resistance were revealed among the strains coming from the Central, Siberian and Volga federal regions of Russia: macrolides - three strains sampled in 2011; tetracyclines - two strains sampled in 2011 and one strain sampled in 2012.

Full Text

Сифилис — инфекционное заболевание, передаваемое половым путем и являющееся причиной тяжелых поражений нервной системы и висцеральных органов, внутриутробного инфицирования плода. Несмотря на проводимые профилактические мероприятия, сифилис остается эндемичным заболеванием во многих развивающихся странах; в развитых странах регистрируются эпидемии сифилиса. В Российской федерации уровень заболеваемости сифилисом остается достаточно высоким и, по данным государственной статистики 2011 г., составляет 37,6 на 100 000 населения. Данное обстоятельство вызывает необходимость изучения изменчивости возбудителя сифилиса T. pallidum, в первую очередь направленного на выявление отдельных молекулярных типов возбудителя. Молекулярное типирование бледной трепонемы, выделенной от больных сифилисом, впервые было проведено A. Pillay и соавт. в рамках исследований центров по контролю заболеваний (США, Атланта) [1, 2]. показано, что ген arp (acidic repeat protein), кодирующий кислый белок с неизвестными функциями, содержит уникальные повторы, состоящие из 60 пар оснований, причем количество этих повторов варьирует у разных штаммов T. pallidum. подобная вариабельность характерна и для семейства tpr генов (T. pallidum repeat). В состав семейства tpr входит 12 генов, часть которых, как предполагают, кодирует 36 L № 3, 2013 экспонированные на поверхности белки. A. Pillay с со-авт. была разработана методика исследования, заключавшаяся в обнаружении ДНК бледной трепоне-мы в образцах соскобов сифилитических высыпаний больных первичным и вторичным сифилисом путем амплификации региона гена polA в полимеразной цепной реакции (пцР) и последующего проведения молекулярного типирования T. pallidum по двум вариабельным генам-мишеням: гену arp и семейству генов tpr. Группой A. Pillay проведено молекулярное типирование T. pallidum на 201 биообразце, полученном от больных сифилисом в клиниках пяти городов южной Африки [2]. В ходе исследования было установлено 15 типов штаммов T. pallidum, идентифицированных на основании выявленных вариантов гена arp (содержавших по 6—8, 10—20 или 22 повторяющихся 60-нуклеотидных участка гена), а также 10 вариантов фрагмента гена tpr. путем сопоставления результатов определения arp повторов и вариантов гена tpr в ходе исследования было идентифицировано 35 субтипов T. pallidum. В большинстве исследованных образцов определялся субтип 14d. Анализ последовательности нуклеотидов гена tp0548 T. pallidum [3] привел к тому, что наиболее распространенный подтип 14d был разделен на 4 отдельные подгруппы (14d/c, 14d/f, 14d/g, 14d/i), а подтипы 12a и 14а были дополнительно разделены на 2 группы каждый. В работе R. Peng и соавт. приведены результаты метаанализа публикаций, касавшихся молекулярного типирования T. pallidum и эпидемиологии сифилиса в разных странах мира, содержавшихся в пяти информационных базах данных (PubMed, Embase, EBScO, Google Scholar, cNKI) за период с 1998 г. (дата выхода первой публикации о типировании T. pallidum) по 2010 г. [4]. На основании анализа сведений, приведенных в 14 отобранных для метаанализа статьях, были выявлены 27 наиболее распространенных субтипов бледной трепонемы; среди них превалировали субтипы: 14d, 14f, 14a, 13d и 15d. при этом в Китае доминантным субтипом являлся 14f, на втором месте — 14d [5], в США доминировал 14f [6], в Канаде — 14d [7], в юАР — 14d, на втором месте — 14a, на третьем — 14i [2, 8], на Мадагаскаре — 14d [1], в португалии — 14а, на втором месте — 14d [9], в Шотландии — также субтип 14d [10]. Самым распространенным почти для всех территорий, где проводились исследования, оказался штамм 14d. Авторы предполагают, что штамм 14d, вероятно, был исходным штаммом бледной трепонемы, по крайней мере, для исследованных территорий. по мнению исследователей, применение методов молекулярного типирования возбудителей инфекционных заболеваний способствует лучшему пониманию закономерностей распространения разных субтипов возбудителя из одного региона или страны в другие, позволяет изучить зависимость гетерогенности суб типов от географического расположения региона, установить возможную связь субтипов возбудителя с вирулентностью, определить особенности передачи инфекции между половыми партнерами. В отсутствие противосифилитической вакцины контроль над распространением сифилиса в значительной степени зависит от своевременного выявления новых случаев заболевания и лечения антибиотиками больных сифилисом и их половых партнеров. пенициллин и другие ß-лактамные антибиотики до сих пор являются основными препаратами, используемыми для лечения сифилитической инфекции в Российской федерации [11]. Несмотря на более чем 60-летний мировой опыт применения пенициллина для лечения сифилиса, клинически доказанных случаев неудач лечения больных сифилисом данным антимикробным препаратом, связанных с появлением резистентности T. pallidum к пенициллину, до сих пор не описано. Однако имеются факты, указывающие на возможность развития резистентности бледной трепонемы к антимикробным препаратам. Об этом свидетельствуют неудачи лечения сифилиса эритромицином [12, 13], подтверждение in vitro устойчивости T. pallidum к макролидам, обусловленной мутацией в генах, кодирующих 23S rRNA [14], обнаружение T. denticola, устойчивых к тетрациклину и эритромицину [15, 16], выявление плазмид, обеспечивающих устойчивость к ß-лактамам ряда штаммов T. pallidum [17]. В связи с вышеизложенным исследование резистентности T. pallidum к антимикробным препаратам является важным, так как распространение антибиотикорезистентных штаммов T. pallidum может привести к неконтролируемому росту заболеваемости сифилисом. T. pallidum является некультивируемым на искусственных питательных средах патогеном, поэтому изучение антибиотикоре-зистентности может осуществляться только с помощью молекулярно-биологических методов. Исследования, направленные на определение молекулярных типов штаммов бледной трепонемы, полученных на территории Российской федерации, и их резистентности к антимикробным препаратам, до настоящего времени не проводились. Целью настоящего исследования явилось изучение распространения молекулярных типов штаммов T. pallidum, полученных от больных сифилисом на территории Российской федерации, и резистентности штаммов T. pallidum к антимикробным препаратам (макролидам, тетрациклинам, ß-лактамам). Материал и методы В 2011—2012 гг. от больных с лабораторно подтвержденным диагнозом первичного сифилиса половых органов, первичного сифилиса анальной области, первичного сифилиса других локализаций и вторичного сифилиса кожи и слизистых оболочек было получено 190 биологических образцов, содержавших ДНК Вестник дерматологии и венерологии Научные исследования л 37 T. pallidum. биологические образцы представляли собой межтканевую серозную жидкость, полученную путем поскабливания стерильной ложкой фолькмана поверхности эрозивных и язвенных высыпных элементов, расположенных на коже и слизистых оболочках больных первичным и вторичным сифилисом. получение и хранение штаммов T. pallidum в медицинских организациях дерматовенерологического профиля субъектов Российской федерации, а также их транспортировка в фГБу «ГНцДК» Минздрава России осуществляли в соответствии с ранее разработанными в ГНцДК стандартными операционными процедурами. Транспортировку биологического материала, содержащего T. pallidum, в ГНцДК осуществляли в условиях низкой температуры, гарантирующей сохранность генетического материала возбудителя сифилиса. Для получения референсной контрольной геномной ДНК Treponema pallidum subsp. pallidum при проведении исследований использовали штамм Nichols патогенной T. pallidum, выделенный из ткани лабораторных кроликов, на которых перевивалась указанная культура. Для получения контрольной геномной ДНК использовали штамм Escherichia coli XL1-Blue. Дизайн исследования С целью установления молекулярных типов штаммов T. pallidum, циркулирующих на территории Российской федерации, была изучена их вариабельность с использованием молекулярных методов типирования по трем генам; arp, tpr и tp0548. Изучение вариабельности штаммов T. pallidum по гену arp проводили методом полимеразной цепной реакции (пцР) с последующей детекцией продуктов амплификации участка гена arp методом гель-электрофореза и присвоением штамму T. pallidum цифрового кода, соответствующего количеству 60-ну-клеотидных повторов в гене arp. Типирование штаммов T. pallidum по гену tpr проводили на основании анализа полиморфизма длин рестрикционных фрагментов (пДРф) участка гена tpr, для чего продукты амплификации пцР обрабатывали ферментом рестриктазой; по итогам исследований штамму T. pallidum присваивали буквенное обозначение субтипа (Tru9I пДРф: a, b, с, d, e, g, h, i, j, k, l или p). Молекулярное типирование штаммов T. pallidum по гену tp0548 было осуществлено путем определения нуклеотидной последовательности вариабельного участка гена tp0548 методом секвенирования; в результате исследования штамму T. pallidum присваивали дополнительное буквенное обозначение. по итогам исследования каждому штамму T. pallidum присваивали обозначение молекулярного типа, состоявшее из одного цифрового и двух буквенных символов. Для определения резистентности штаммов T. pallidum к макролидам с применением метода секвенирования были изучены две известные мутации в генах, кодирующие 23S rRNA T. pallidum в положениях A2058G и A2059G/c, обусловливающие развитие резистентности T. pallidum к макролидам. Для определения резистентности штаммов T. pallidum к тетрациклинам было изучено наличие детерминанты tetB (с помощью метода пцР), являющейся молекулярным маркером резистентности микроорганизма к тетрациклинам. Кроме того, при помощи метода секвенирования было изучено наличие точечной мутации в гене, кодирующем 16S rRNA в позиции G1058c, которая также может ассоциироваться с развитием резистентности T. pallidum к тетрациклинам. С целью определения резистентности штаммов T. pallidum к ß-лактамам были изучены структуры генов Тр47 и Tromp, которые кодируют мишени действия ß-лактамов. Для выявления возможных мутаций в генах Тр47 и Tromp было проведено их полноразмерное секвенирование с последующим сравнением полученных нуклеотидных последовательностей с ре-ференсным штаммом T. pallidum. Методы исследования Выделение геномной ДНК T. pallidum и E. coli проводили с использованием набора «ДНК-сорб-АМ» (Нпф «Литех»), согласно инструкции производителя. Выделение геномной ДНК T. pallidum из гомогенизированной ткани кролика, инфицированного T. pallidum, проводили при 37 °С в течение ночи с использованием набора Diatom™ DNA Prep 100 (фирма «Изоген»): к 25—35 мг измельченной ткани добавляли 400 мкл лизирующего буфера (трис-Hcl pH8,0 — 50 мM; ЭДTA — 100 мM; SDS 1%) и 12 мкл протеиназы К (100 мкг/мл). Образцы выделенной ДНК до проведения исследования хранили при -20 °С. Определение ДНК T. pallidum в полученных биообразцах осуществляли в пцР с праймерами к гену polA (регион 1156-1531 пара оснований), кодирующему фермент ДНК-полимеразу I T. pallidum (табл. 1). В качестве матрицы при проведении пцР использовали тотальную бактериальную ДНК, выделенную из биологических образцов. после проведения пцР с помощью электрофоретического анализа выявляли polA-положительные образцы, что служило подтверждением наличия в биообразце ДНК бледной трепонемы. На рис. 1 представлена электрофореграмма, на основании анализа которой биологические пробы отбирались для дальнейшего исследования. С целью проведения молекулярного типирования штаммов T. pallidum по генам arp, tpr и tp0548 и определения молекулярных детерминант антибиотикорезистентности штаммов T. pallidum к макролидам (ген, кодирующий 23S rRNA, в положениях A2058G и A2059G/C), тетрациклинам (ген, кодирующий 16S rRNA, позиция G1058C, детерминанта tetB) и ß-лактамам (гены Тр47 и Tromp) с помощью про- 38 L № 3, 2013 І Таблица 1 Праймеры к гену polA T. pallidum Ген Последовательность 5'—3' polA tgc gcg tgt gcg aat ggt gtg gtc cac agt gct caa aaa cgc ctg cac g 376 bp M 87 88 89 90 91 92 93 94 95 96 97 98 99 K+ К- H=0 M Электрофореграмма продуктов амплификации участка гена polA T. pallidum. р 1 Цифрами обозначены номера исследованных биообразцов. К+ — положительный контроль, (референсная . геномная ДНК T. pallidum subsp. pallidum str. Nichols), К- и H2O — отрицательные контроли, не содержавшие ДНК T. pallidum (контрольная ДНК E. coli и вода соответственно), М — маркеры длин ДНК; 376 bp — расчетный размер продукта амплификации в парах нуклеотидов граммы Oligo6 были подобраны и использованы пары праймеров (табл. 2). Полимеразная цепная реакция. Амплификацию фрагментов ДНК изучавшихся фрагментов генов T. pallidum проводили с помощью пцР. Для этого использовали фермент Taq-полимеразу и буфер к ней фирмы Fermentas. Конечный объем реакционной смеси в пцР составил 25 мкл; условия проведения пцР для получения амплифицированных фрагментов ДНК соответствующих генов T. pallidum представлены в табл. 3. пцР осуществляли на амплификаторах i-Cy-cler и Dyad (фирма Bio-Rad), «Терцик» (фирма «ДНК-Технология»). Для расщепления ДНК T. pallidum использовали эндонуклеазу рестрикции Tru9I (фирма SibEnzym) из расчета 1 Е фермента на 1 мкг ДНК. Инкубацию ДНК с ферментом проводили при температуре 65 °С в течение 1—2 ч., инактивацию фермента — при 80 °С в течение 20 мин. Гель-электрофорез осуществляли в горизонтальных агарозных гелях с концентрацией агарозы от 1 до 2% и содержанием бромида этидия 0,5 мкг/ мл в течение 30—60 мин. при комнатной температуре в трис-ацетатном буфере (0,04 М трис-ацетат рН 8,1; 0,002 М эДТА) при напряжении электрического поля 170 В в течение 30—60 мин. Метод секвенирования. С целью определения нуклеотидных последовательностей амплифициро-ванные фрагменты ДНК соответствующих генов об рабатывали ферментами (экзонуклеазой I E. coli и креветочной щелочной фосфатазой) для получения чистого препарата ДНК, не содержащего компонент амплификационной смеси. Сиквенсовую пцР осуществляли с использованием меченых терминирующих нуклеотидов, ранее подобранных праймеров (см. табл. 2) и коммерческого набора реагентов Big Dye Terminator v 3.1 Sequencing RR-100 (Applied Biosystems). Секвени-рование фрагментов ДНК в соответствии с разработанным протоколом проводили на приборе 3730 Genetic Analyzer (Applied Biosystems, США) с использованием программного обеспечения 3730 Data collection v 3.0. Анализ нуклеотидных последовательностей осуществляли с помощью программ Sequencing Analysis 5.3.1, Vector NTI 9.1 и DNA Star Edit Seq. Выравнивание нуклеотидных последовательностей выполнялось с помощью программы Mega5 Alignment Explorer (рис. 2). Результаты молекулярного типирования штаммов T. pallidum. после выделения суммарной геномной бактериальной ДНК из биообразцов, полученных от больных сифилисом, наличие ДНК T. pallidum было подтверждено методом пцР в 190 биообразцах. Амплифицированные в результате пцР фрагменты ДНК T. pallidum были оценены с помощью молекулярно-биологических методов, позволяющих дифференцировать штаммы T. pallidum по трем вариабельным генам: arp, tpr и tp0548. В результате исследования выборки штаммов T. pallidum по гену arp каждому штамму T. pallidum был Вестник дерматологии и венерологии Научные исследования л 39 I Праймеры, использованные в работе для проведения молекулярного типирования по генам arp, Таблица 2 tpr и tp0548 и определения молекулярных детерминант антибиотикорезистентности штаммов T. pallidum Ген Последовательность праймеров arp caa gtc agg acg gac tgt cc ggt atc acc tgg gga tgc tpr внешние act ggc tct gcc aca ctt ga cta cca gga gag ggt gac gc tpr внутренние cag gtt ttg ccg tta agc aat caa ggg aga ata ccg tc tp0548 ggt ccc tat gat atc gtg ttc g gtc atg gat ctg cga gtg g 23S rRNA gtc tcc cac cta tac tac aca t gga gag gtt cgt ggt aac aca tetB atc ctt tct ggg ctt cca ttg ccg agc agg gat ttc tcc ac 16S rRNA acg cga acg cat taa gtg tac cgc ccc acc ttc ctc cgg ttt gtc a 7 4 tp cag aca ttc tcg ctc ctc gta gc gcg cat ggc tct gag cat ag tromp ctg tag ctg ctt atg cga gga acg gct ctt cta ccc act caa присвоен код, соответствующий количеству уникальных повторов, состоящих из 60 пар оснований, в гене arp; всего было выявлено 4 типа штаммов: 1-й тип штаммов содержал в гене arp 11 60-нуклеотидных повторов (тип 11; 1 штамм; 0,53%), 2-й тип штаммов содержал 13 повторов [тип 13; 1 (0,53%) штамм], 3-й тип штаммов содержал 14 повторов [тип 14; 187 (98,4%) штаммов]; и 4-й тип штаммов содержал по 20 повторов [тип 20; 1 (0,53%) штамм]. Типирование T. pallidum по гену tpr заключалось в определении полиморфизма длин рестрикционных фрагментов (ПДРФ) участка гена tpr величиной 1848 пар оснований и определении методом «гнездовой» ПЦР молекулярного типа штамма T. pallidum (12 вариантов: a, b, с, d, e, g, h, i, j, k, l или p). Распределение типов штаммов T. pallidum в зависимости от пДРф участка гена tpr T. pallidum представлено в табл. 4. По результатам анализа данных типирования штаммов T. pallidum по гену tpr в изучавшейся выборке штаммов T. pallidum было выявлено 3 типа штаммов: тип a — 1 (0,53%) штамм, тип b — 6 (3,16%) штаммов и тип d — 183 (96,31%) штамма. На электрофореграмме (рис. 3) представлены 3 типа штаммов T. pallidum, выявленных на основа нии определения длины рестрикционных фрагментов участка гена tpr: a, b и d. В результате молекулярного типирования по двум генам (arp и tpr) каждому штамму T. pallidum был присвоен код, состоявший из цифрового и буквенного обозначений; всего в исследовании было выявлено 6 типов штаммов: 11d — 1 (0,53%) штамм, 13d — 1 (0,53%) штамм, 14a — 2 (1,05%) штамма, 14b — 6 (3,16%) штаммов, 14d — 179 (94,20%) штаммов и 20d — 1 (0,53%) штамм. Типирование нуклеотидных последовательностей участка гена tp0548 длиной 85 пар оснований в позиции 131-215 позволило выделить дополнительно субтипы T. pallidum: a — 1 (0,53%) штамм, c — 1 (0,53%) штамм, f — 183 (96,31%) штамма и g — 1 (0,53%) штамм. При анализе нуклеотидных последовательностей фрагмента гена tp0548 была обнаружена не описанная ранее в литературе замена нуклеотидов в положении 171: вместо цитозина (характерного для типов а—d и h) и гуанина (характерного для типов e, f, g и i) в данном положении в 4 (2,10%) штаммах T. pallidum находился тимин (T171T). Данная нуклеотидная замена является значимой, так как приводит к замене аминокислоты в белковой молекуле T. pallidum. Новому типу штаммов было присвоено буквенное обозначение T. 40 к № 3, 2013 I Таблица 3 Условия проведения ПЦР при исследовании генов T. pallidum Количество компонентов для исследования в ПЦР генов T. pallidum для реакционной смеси polA arp tpr внешние tpr внутренние tp0548 23S rRNA tetB 16S rRNA tp47 tromp 10x Buffer 1х 1х 1х 1х 1х 1х 1х 1х 1х 1х dNTP 10мМ 0,2мМ 0,2мМ 0,2мМ 0,2мМ 0,2мМ 0,2мМ 0,2мМ 0,2мМ 0,2мМ 0,2мМ Праймер fw 10рто1 20 ртої 10ртої 20 ртої 10ртої 10ртої 10ртої 10ртої 10ртої 10ртої Праймер rev 10рто1 20 ртої 10ртої 20 ртої 10ртої 10ртої 10ртої 10ртої 10ртої 10ртої Taq полимераза 2 ед. 2,5 ед. 2 ед. 2,5 ед. 2 ед. 2 ед. 2 ед. 2 ед. 2 ед. 2 ед. Вода до конечного объема смеси DNA, мкл 5 7 3 3 5 5 3 3 3 2 Конечный объем смеси, мкл 25 25 25 50 25 25 25 25 25 25 Режимы ПЦР Температура (°С) и время (сек. — '', мин. — ') 1 цикл '5 7 5 9 95—5' 95—5' 95—5' '2 1 5 9 94—5' 95—5' 95—5' 95—5' '5 1 94 Денатурация 95—40'' 95—20'' 94—1' 94—1' 95—1' 94—20'' 94—30'' 95—30'' 94—30'' 94—30'' Отжиг 65—1' '0 2 61 '2 1 64 63—2' 6 0 1 '0 2 61 67—30'' '0 3 1 2 7 68—30'' 61—15'' Элонгация 72—1' 72—40'' 68—1' 68—1' 72—1' '0 2 1 2 7 '0 3 1 2 7 '0 3 1 2 7 72—1' 72—1' Достройка 72—5' 72—7' 68—7' 68—7' 72—10' 72—5' 72—7' 72—10' 72—7' 72—5' Количество циклов 45 35 35 45 40 35 35 34 35 35 Ожидаемый размер 376 от 751 2196 1848 346 276 600 330 1550 1124 продукта (в парах оснований) Примечание. Указание на режим проведения ПЦР: «95—15'» обозначает температуру этапа реакции 95 °С длительностью 15 минут; а «61—20''» — температуру -61 °С длительностью 20 секунд. Фрагмент интерфейса программы Mega5: Alignment Explorer с результатами выравнивания последовательностей разных типов штаммов T. pallidum по гену tp0548 T. pallidum. Слева по вертикали — номера образцов от 1 до 10 с буквенными обозначениями, соответствующими типу изучаемого фрагмента гена tp0548; в центральной части представлены нуклеотидные последовательности штаммов T. pallidum, соответствующие изучаемому фрагменту гена tp0548; цветом выделены нуклеотиды: синим — цитозин, зеленым — аденин, фиолетовым — гуанин, красным — тимин, белым — «брешь-делеция», возникшая при выравнивании нуклеотидных последовательностей Вестник дерматологии и венерологии Научные исследования л 41 1 Таблица 4 ПДРФ участка гена tpr T. pallidum Длина рестрикционных Тип Tru9I ПДРФ фрагментов участка гена tpr i. pallidum (пары оснований) a b c d e f g 911 + + + + + + + 901 + + + 804 + + + + 722 + + + + + + 524 + + + + + 425 + + + + 382 + + + + + + + Примечание. Буквами обозначены типы штаммов T. pallidum, соответствующие полиморфизмам длин фрагментов ДНК, выявленных после обработки продуктов амплификации рестриктазой Tru9I. Серым цветом обозначены сочетания длин рестрикционных фрагментов, выявленные в изучавшейся выборке штаммов. dddddbclbadddtl 72 73 74 75 76 77 78 79 80 81 82 83 K+K-ttOM Электрофореграмма штаммов T. pallidum типов a, b и d, выявленных на основании определения ПДРФ участка гена tpr T. pallidum. Рис. 3. Сверху — буквенное обозначение установленного типа штамма по гену tpr, снизу цифрами обозначены номера биологических образцов, К+ — положительный контроль (референсная геномная ДНК T. pallidum subsp. pallidum str. Nichols); К- и H2O — отрицательные контроли, не содержавшие ДНК T. pallidum (контрольная ДНК E. coli и вода соответственно); М — маркер длин ДНК Таким образом, на основании результатов молекулярного типирования по трем генам (arp, tpr и tp0548) каждому штамму T. pallidum был присвоен индивидуальный код, состоявший из трех обозначений (одного цифрового и двух буквенных). Распределение молекулярных типов штаммов T. pallidum приведено в табл. 5. Таким образом, как следует из приведенных данных, в результате молекулярного типирования российской выборки штаммов T. pallidum по трем генам (arp, tpr и tp0548) было выявлено 10 молекулярных типов T. pallidum. Доминирующим молекулярным типом среди штаммов T. pallidum, обнаруженных на территории Российской Федерации, так же как и во многих других странах мира (рис. 4), являлся молекулярный тип 14 (98,4%), подтип 14d/f (91,03%); доля субтипов 14b/f и 14d/T молекулярного типа 14 составила 3,16 и 2,10% соответственно; на долю каждого из остальных субтипов (11d/f, 13d/f, 14a/a, 14a/f, 14d/c, 14d/g и 20d/f) приходилось по 0,53%. Результаты определения маркеров антибиотикорезистентности штаммов T. pallidum. Поскольку основными препаратами, используемыми в настоящее время для лечения больных сифилисом, являются ß-лактамные антибиотики (пенициллин, цефтриаксон), макролиды и тетрациклины, определение известных и вероятных генетических детерминант резистентности штаммов T. pallidum было осуществлено по отношению к данным трем группам антимикробных препаратов. Для определения резистентности штаммов T. pallidum к макролидам были изучены две из- 42 к № 3, 2013 I Таблица 5 Результаты молекулярного типирования штаммов T. pallidum по трем генам: arp, tpr и tp0548 Тип штамма по гену arp по гену tpr по гену tp0548 по трем генам (arp, tpr, tp0548) 14d/c тип количество тип количество тип количество тип количество абс. % абс. % абс. % абс. % 11 1 0,53 a 1 0,53 a 1 0,53 11d/f 1 0,53 13 1 0,53 b 6 3,16 c 1 0,53 13d/f 1 0,53 14 187 98,40 d 183 96,31 f 183 96,31 14a/a 1 0,53 20 1 0,53 g 1 0,53 14a/f 1 0,53 T 4 2,10 14b/f 6 3,16 0,53 14d/f 173 91,03 14d/g 0,53 14d/T 2,10 20d/f 0,53 Всего 190 100 190 100 190 100 10 190 100 вестные мутации в генах, кодирующих 23S рРНК T. pallidum, в положениях A2058G и A2059G/C, обусловливающие развитие резистентности T. pallidum к макролидам. Для этого были применены методы ПЦР и секвенирования с использованием праймеров к участку гена, кодирующего 23S rRNA и содержащего сайты предполагаемых мутаций. При анализе полученных после проведения реакции секвенирования расшифрованных последовательностей участка гена, кодирующего 23S rRNA, Рис. 4. Распространение наиболее часто встречающихся субтипов штаммов T. pallidum в странах мира 4 4 3 5 Вестник дерматологии и венерологии Научные исследования л 43 было обнаружено 3 штамма с мутацией в положении A2058G. Данные штаммы были получены из Приволжского, Центрального и Сибирского федеральных округов. Мутаций в позиции 2059 гена, кодирующего 23S rRNA, обнаружено не было ни у одного из штаммов T. pallidum. Для определения резистентности штаммов T. pallidum к тетрациклинам было изучено наличие детерминанты tetB, ответственной за развитие устойчивости микроорганизмов к тетрациклинам и имеющей у T. pallidum хромосомную локализацию. Детерминанта tetB кодирует фермент, который переводит тетрацикли-ны в неактивную форму; выявление этого гена свидетельствует о наличии резистентности микроорганизма к тетрациклинам. Определение гена tetB T. pallidum осуществлялось методом ПЦР с использованием соответствующих праймеров. В качестве положительного контроля использовали геномную ДНК E. coli штамм XL1-Blue, содержащую транспозон Tn10, в состав которого входит ген tetB. В качестве отрицательного контроля использовали T. pallidum str. Nichols. Выявление продукта в случае XL1-Blue говорило об успешном прохождении полимеразной реакции (рис. 5). По результатам проведенного исследования был выявлен 1 штамм T. pallidum, содержавший детерминанту tetB. Штамм был получен из Дальневосточного федерального округа Российской Федерации (Хабаровский край). Кроме гена tetB, обусловливающего развитие резистентности микроорганизмов к тетрациклинам, было определено наличие точечной мутации в гене, кодирующем 16S rRNA, которая также может ассоциироваться с развитием резистентности T. pallidum к те трациклинам. Данный ген кодирует 16S rRNA, входящую в состав 30S субъединицы рибосомы. Действие тетрациклина основано на ингибировании синтеза белка путем связывания с 30S субъединицей рибосомы через 16S rRNA; при этом наличие мутации в гене, кодирующем 16S rRNA , приводит к блокированию действия антибиотика и развитию резистентности. Для изучения точечной мутации в гене, кодирующем 16S rRNA (в позиции G1058C) T. pallidum, были использованы ПЦР и метод секвенирования. В результате анализа последовательностей участка гена, кодирующего 16S rRNA, было обнаружено 2 штамма T. pallidum, несущих мутации в положении G1058C, ассоциированном с резистентностью трепо-нем к антибиотикам класса тетрациклинов (рис. 6). Штаммы были получены из Сибирского и Центрального федеральных округов. Точная локализация мутаций, которые могут вызвать развитие резистентности T. pallidum к ß-лактамам, в настоящее время неизвестна. В связи с данным обстоятельством при определении резистентности штаммов T. pallidum к ß-лактамам была изучена структура генов Тр47 и Tromp, которые кодируют мишени действия ß-лактамов и потенциально могут нести ответственность за развитие устойчивости T. pallidum к ß-лактамным антибиотикам: ген Тр47 кодирует пенициллинсвязывающий белок PBP, ген Tromp кодирует белок Tromp — каналообразующий порин, образующий поры, сквозь которые могут проникать молекулы антибиотика. Для выявления возможных мутаций в генах Тр47 и Tromp было проведено их секвенирование с применением праймеров к полноразмерным генам с последующим сравнением полученных нуклеотид- Электрофореграмма продукта амплификации участка гена tetB T. pallidum. Показано отсутствие продукта ПЦР для всех исследованных проб и его наличие в пробе К+ — E. coli Рис. 5. штамм XL1-B№e, являющейся положительным контролем реакции. Цифрами обозначены номера исследованных биообразцов, К- и H2O — отрицательные контроли (референсная геномная ДНК T. pallidum subsp. pallidum str. Nichols и вода соответственно), М — маркер длин ДНК, 600 bp — расчетный размер продукта амплификации в парах нуклеотидов 44 к № 3, 2013 Hk М5: Alignment Lxplortr (16S_a отчат.ггиі} Oita Bit xwdi ttgmwt web snhmw nsttof Hdp DÆHÜ - a w ^ _ |! DMA Sequences Translated Protein Sequences | n Seecias/Abbrv 1. Q1I15633Ï95 Tr val subie. ваі rr.-ï. Hieboii tCTCTT CACAGGÏGCTGCATC j "TCrCGTCAGCTCGÏGCCCrGAGGTGTTGG г Ü0Z ССГСТТСАСАССТССТССАТС ; :i СГССТСАССТССЇССССГСАССТСТТССэ. .□75 СО» tcrCTTCACACCTGCTCCATC - 7TCrCGTCAGCTCGÏGCCGrGAGGTGTTGG .СР07 101 ^CTCTTCACACCTCCTCCATÇ ’ :ТСТССТСАССТССТССССГСАССТСТТСС Б. .ОСЄ KOZ CCTCTTGACAGGTGCTGCATC r ^TCrCGTCAGCTCGTGCCCrGAGGTGTTGG 6Т .011 СО! tcTCTT CACACCTCCTCCATC j ИТСГСС-ТСАССТССТССССГСАССТС-ТТСС- 7. .01Z CÛZ ÜCrCÏTCACACGTGCTGCATG ^TCrCGTCA&CTCGÏGCCGrGAGGTGTTGG Є, БОД ■CCTCTTCACACGTCCTGCATC j ÜTCrCGTCAGCTCGTGCCCrCAGGTGTTCG- 3. .□14 БОЕ ÎCÏCTT&ACA5GTGCTCCATG j :i[JICG7CAGCTCGTGCCGTGACG7G7TCC- 10- 01 £ А01 jCTETTCACACGTCCTGCATC 2 ITCTCC7CACCTCCTCCCCTCACCTC7TCC 11. 01* XÙ2 CCrCTT&ACASGTGCT&CATG 7. :tgtcgtcagctcgïgccgtgacgtgttgg 12. огэ ЮЗ CCTCTTCACACGTGCTGCATC î ZTCrCGTCA&CTCGTGCtCrCAGGTGTTGG- 15. □Z« Т>04 J C T C T I CACAGGTGCTGCATG ". ÜTCrCGTCAGCTCGTGCCCrGAGGTGTTGG 14. огл СЯ4 ССТСТТСАСАССТССТССАТС ]TtrCCTCACCTCCTCCCtrtAtCTC7TtC. 15, оея БОЗ CCrCTTCACACCTGCTCCATC :TCrCCTCAGCTCGTGCCCrCAGCTGTTGG 1É, ОЭС £04 ССТСТТСАСАССТССТССАТС .j CTCTCCTCACCTCCTCCCCTCACCTCTTCC 17. 031 ЛОЗ :crCTT[JACACGTGCTtCATC - ÜTCrCGTCAGCTCGTGCCCrGAGGTGTTGG 1Є, ОМ М4 ÏCTCTT CACACÇTCCTCCATC - :ТСГССТСАССТССТССССГСАССТСТТССp » Фрагмент интерфейса программы Mega5: Alignment Explorer с данными выравнивания последовательно' 6 стей участка гена, кодирующего 16S рРНК T. pallidum. Выделен сайт, содержащий нуклеотидную замену в позиции G1058C ных последовательностей с референсным штаммом T. pallidum (Treponema pallidum subsp. pallidum str. Nichols chromosome, complete genome NCBI Reference Sequence: Nc_000919.1) с целью выявления возможных различий, влияющих на устойчивость штамма к ß-лактамным антибиотикам. На основании анализа продуктов секвенирования гена tp47 в большинстве полученных штаммов было обнаружено несоответствие их нуклеотидных последовательностей с референсным штаммом T. pallidum str. Nichols: в позиции 124 вместо гуанина находился тимин (рис. 7), что приводит к замене в белке Tp47 в ^ М5: Alignment Explorer (1р47_в от*«т,mai) Dite Edt Se»ch АЦплелс Web sequencer W*toy Help I D q£ Q ïïf ;йїі j ,l DNA Sequence; Tran slated Prole in Sequences 5ï«Cl(l/Ubrv ■H- ■H-M-H-H+H- + 4H-H-M-H+I+H-H-I- ■ -I-H-M+I-H+I- -I- -l-H+l+H-t+H- +M+I-H-H+M- 1. VF*7 -ag T G A A A Г cc ОС АСА GA GGACAT т с т ссс ÇC ЛАОС Т С ACÇ ос т Г О АТ С G ;t GACAAGC TAG GC T GT C С ATC GGCAA E. .005 Eü£ 3AG T G A A A Г cc GC AGA CA CGАСА Г т с т GCC сс AAGC Т CAC С сс т Г CAT С G ;t GACAAGC Г TAC CC Г G* C С ATC CGC A A 3, ,03* WG ^ JlC T САІАТ cc CC АСА CA CCACAT т с т ссс сс А АС-С Т CACÇ сс т Г CAT С С ’T CACAACC Г TAC cc Г CT C CATC C CC A A 4. .039 Fdt 3 AG T G A A A Г c c GC AGA CA CGАСА Г 7 с т GC С сс AAGC т САСС GC т Г CAT С G :t GACAAGC Г TAC cc T GT c С ATC CGC A A S. ,07? A05 ’-AC T CAAAT cc CC АСА CA ССЛСЛТ т с т ссс сс AAtC т САСС СС т Г CAT с Cr ’ T САСАЛСС Г TAC cc Г GT c CATC CtCAJL Ë . .003 CCI ^ AG T G A A A Г cc ОС AC A CA GGАСА Г т с т ссс сс А АО С САСС ОС т Г GAT с T :t GACAAGC Г TAG GC T GT c CATC GÇCAA î. .ÛOfi FOI Ï AG T G A A A Г cc CC AGA CA cgaCat т с т GCC сс AAGC т САСС се т Г CAT с T ;t CACAAGC Г TAC CC Г C T c CATC CtC AA S. ,Q9V EU ^AG T G A A A Г ce ОС АСА CA CGAÇА Г т с т ссс сс А АС С т CACÇ CÇ т Г CAT с T ;t CACAACC Г TAC GC T GT c CATC GCC A A 9. .Û£4 ЕСШ jAG - G A A A Г cc CC AGA CA CGАСА Г т с т GCC сс AAGC т САСС сс т Г CAT с T ;t CACAACC Г TAG CC r GT c CATC GGCAA lû 03? IÛE xJlC T C A A AT cc CC АСА CA ССАСАТ т с т ссс сс ААСС 1 САСС сс т Г CAT с T l T CACAACC Г TAC CC T CT c CATC CCCA A 11 040 Edt Зі AG T G A A A Г cc ОС AGA CA CGАСА Г т с т GC С с с A AGC т САСС сс т Г GAT с T ;t GACAAGC Г TAG CC Г GT c CATC GGCAA 12 ÛSÉ 10? ^AC 7 ËA A A T cc CC AGA CA ССЛСЛТ т с т GCC сс AAGC т САСС сс т Г CAT с T ;t CACAACC Г TAC CC Г CT c CATC C CC A A lâ OSfi E09 ;ac T G A A A f cc GC AC A GA GGACA Г т с 7 ссс сс AAG С т САСС GC т т GAT с T ; T GA CAAG C т TAG GC T G T c CATC GC CAA 14 Û?1 ËOS jAC T САААГ cc CC AGA CA CdАСА Г т с т GCC сс AAGC т САСС сс т Г GAT с T ;t GACAAGC Г TAG CC T GT c CATC GGCAA Р 7 Фрагмент интерфейса программы mega5: Alignment Explorer с данными выравнивания последовательно-Рис. 7 стей участка гена tp47 T. pallidum. Выделен сайт, содержащий замену G124T Вестник дерматологии и венерологии Научные исследования л 45 позиции 394 аминокислоты серина на аргинин. Однако обнаруженная замена не является значимой (мутантный вариант белка tp47 с делецией D домена в положении 394 демонстрирует уровень ß-лактамазной активности на уровне дикого типа) и не может влиять на устойчивость микроорганизма к ß-лактамам. при анализе результатов секвенирования последовательностей гена Tromp во всех случаях были обнаружены различия с референсным штаммом T. pallidum str. Nichols (база данных NcBI): в позиции 22 вместо цитозина находился гуанин, однако обнаруженная замена не является значимой для функциональной активности белка, так как локализована в области сигнального пептида, необходимого для экспорта белка через цитоплазматическую мембрану. Таким образом, в результате изучения молекулярных маркеров резистентности T. pallidum к ß-лактамным антибиотикам был обнаружен ряд замен в генах Тр47 и Tromp, которые, однако, не являются значимыми для функциональной активности белка и не могут влиять на резистентность штаммов T. pallidum к ß-лактамам. Заключение В результате проведенных в ГНцДК исследований впервые осуществлено молекулярное типирование выборки штаммов T. pallidum, циркулирующих на территории Российской федерации. На основании результатов молекулярного типирования 190 штаммов T. pallidum по трем генам (arp, tpr и tp0548) каждому штамму T. pallidum был присвоен свой индивидуальный код или тип, состоящий из трех обозначений (цифрового и двух буквенных). Всего было выявлено 10 типов штаммов T. pallidum. Доминирующим молекулярным типом среди штаммов T. pallidum, обнаруженных на территории Российской федерации, являлся молекулярный тип 14 (98,4%), подтип 14d/f (91,03%); доля субтипов 14b/f и 14d/T молекулярного типа 14 составила соответственно 3,16 и 2,10%; на долю каждого из остальных субтипов (11d/f, 13d/f, 14a/a, 14a/f, 14d/c, 14d/g и 20d/f) приходилось по 0,53%. В ходе выполнения научно-исследовательской работы было проведено определение известных и потенциальных молекулярных маркеров антибио-тикорезистентности T. pallidum к трем видам антимикробных препаратов: макролидам, тетрациклинам и ß-лактамам. В результате изучения молекулярных маркеров антибиотикорезистентности T. pallidum к антибиотикам класса макролидов в трех штаммах T. pallidum была обнаружена мутация в позиции 2058 гена, кодирующего 23S rRNA T. pallidum, являющаяся молекулярным маркером устойчивости к макролидам. В двух штаммах T. pallidum была обнаружена мутация в позиции 1058 гена, кодирующего 16S rRNA, являющаяся молекулярным маркером резистентности T. pallidum к тетрациклинам. Изучение другого маркера резистентности к действию антибиотиков класса тетрациклинов, гена tetB, показало наличие детерминанты устойчивости у одного штамма T. pallidum. Резистентность к ß-лактамам среди изученных штаммов T. pallidum выявлена не была, о чем свидетельствовало отсутствие значимых мутаций в генах Тр47 и Tromp, кодирующих мишени действия ß-лактамов. Штаммы T. pallidum, у которых были выявлены мутации, были получены из приволжского, Сибирского, центрального и Дальневосточного федеральных округов Российской федерации. проведенное исследование является первым в Российской федерации опытом молекулярного типирования и определения антибиотикорезистент-ности штаммов возбудителя сифилиса Treponema pallidum. Внедрение методов молекулярной эпидемиологии в систему мониторинга возбудителей инфекций, передаваемых половым путем, способствует установлению закономерностей распространения различных (в том числе резистентных к отдельным антимикробным препаратам и мультирезистентных) штаммов возбудителей между федеральными округами и пограничными с Российской федерацией государствами, позволяет разрабатывать профилактические меры, направленные на предупреждение распространения таких штаммов и нормализацию эпидемиологической обстановки по заболеваемости инфекциями, передаваемыми половым путем, в Российской федерации. I

About the authors

A A Kubanova

State Research Center of Dermatovenereology and Cosmetology, Ministry of Healthcare of the Russian Federation

Korolenko str. 3, bldg 6, Moscow, 107076, Russia

A A Kubanov

State Research Center of Dermatovenereology and Cosmetology, Ministry of Healthcare of the Russian Federation

Korolenko str. 3, bldg 6, Moscow, 107076, Russia

N V Frigo

State Research Center of Dermatovenereology and Cosmetology, Ministry of Healthcare of the Russian Federation

Korolenko str. 3, bldg 6, Moscow, 107076, Russia

I A Volkov

State Research Center of Dermatovenereology and Cosmetology, Ministry of Healthcare of the Russian Federation

Korolenko str. 3, bldg 6, Moscow, 107076, Russia

S V Rotanov

State Research Center of Dermatovenereology and Cosmetology, Ministry of Healthcare of the Russian Federation

Email: rotanov@cnikvi.ru
Korolenko str. 3, bldg 6, Moscow, 107076, Russia

A A Suvorova

State Research Center of Dermatovenereology and Cosmetology, Ministry of Healthcare of the Russian Federation

Korolenko str. 3, bldg 6, Moscow, 107076, Russia

References

  1. Pillay A., Liu H., Chen C.Y. et al. Molecular subtyping of Treponema pallidum subspecies pallidum. Sex Transm Dis 1998; 25: 408—414.
  2. Pillay A., Liu H., Ebrahim S. et al. Molecular typing of Treponema pallidum in South Africa: cross-sectional studies. J Clin Microbiol 2002; 40: 256—258.
  3. Marra C.M., Sahi S.K., Tantalo L.C. et al. Enhanced Molecular Typing of Treponema pallidum: Geographical Distribution of Strain Types and Association with Neurosyphilis. J Infect Dis 2010; 202 (9): 1380—1388.
  4. Peng R.R., Wang A.L., Li J. et al. Molecular Typing of Treponema pallidum: A systematic review and metaanalysis. PLoS Negl Trop Dis. 2011 (Nov); 5 (11): e1273.
  5. Martin I.E., Gu W., Yang Y., Tsang R.S. Macrolide resistance and molecular types of Treponema pallidum causing primary syphilis in Shanghai, China. Clin Infect Dis 2009; 49: 515—521.
  6. Sutton M.Y., Liu H., Steiner B. et al. Molecular subtyping of Treponema pallidum in an Arizona County with increasing syphilis morbidity: use of specimens from ulcers and blood. J Infect Dis 2001; 183: 1601—1606.
  7. Martin I.E., Tsang R.S., Sutherland K. et al. Molecular typing of Treponema pallidum strains in western Canada: predominance of 14d subtypes. Sex Transm Dis 2010; 37: 544—548.
  8. Molepo J., Pillay A., Weber B. et al. Molecular typing of Treponema pallidum strains from patients with neurosyphilis in Pretoria, South Africa. Sex Transm Infect 2007; 83: 189—192.
  9. Florindo C., Reigado V., Gomes J.P. et al. Molecular typing of Treponema pallidum clinicalstrains from Lisbon, Portugal. J Clin Microbiol 2008; 46 (11): 3802—3803.
  10. Cole M.J., Chisholm S.A., Palmer H.M. et al. Molecular epidemiology of syphilis in Scotland. Sex Transm Infect 2009; 85: 447—451.
  11. Приказ Минздрава России № 327 от 25.07.2003 «Об утверждении протокола ведения больных «Сифилис».
  12. Duncan W.C. Failure of erythromycin to cure secondary syphilis in a patient infected with the human immunodeficiency virus. Arch Dermatol 1989; 125: 82—84.
  13. Hashisaki P., Wertzberger G.G., Conrad G.L., Nichols C.R. Erythromycin failure in the treatment of syphilis in a pregnant woman. Sex Transm Dis 1983; 10: 36—38.
  14. Stamm L.V., Bergen H.L. A point mutation associated with bacterial macrolide resistance is present in both 23S rRNA genes of an erythromycin-resistant Treponema pallidum clinical isolate. Antimicrob Agents Chemother 2000; 44: 806—807.
  15. Roberts M.C., Chung W.O., Roe D.E. Characterization of tetracycline and erythromycin resistance determinants in Treponema denticola. Antimicrob Agents Chemother 1996; 40 (7): 1690—1694.
  16. Roberts M.C. Update on acquired tetracycline resistance genes. FEMS Microbiol Lett 2005; 245 (2): 195—203.
  17. Norgard M.V., Miller J.N. Plasmid DNA in Treponema pallidum (Nichols): potential for antibiotic resistance by syphilis bacteria. Scince 1981; 213 (4507): 553—555.

Statistics

Views

Abstract - 654

PDF (Russian) - 303

PlumX

Article Metrics

Metrics Loading ...

Dimensions

Refbacks

  • There are currently no refbacks.

Copyright (c) 2013 Kubanova A.A., Kubanov A.A., Frigo N.V., Volkov I.A., Rotanov S.V., Suvorova A.A.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies