Production and evaluation of the clinical efficacy of the recombinant T. pallidum antigen Tp0453 for syphilis diagnosis

Abstract


Goal. Production of a recombinant T. pallidum antigen Tp0453 and the evaluation of the efficacy of its clinical use for syphilis diagnosis. Materials and methods. To produce the target recombinant T. pallidum antigen, a Tp0453 protein coding fragment of the DNA of the causative agent of syphilis, was cloned into the pET28а vector. Heterological expression of the recombinant T. pallidum antigen was performed in the E. coli BL21 (DE3) strain. The recombinant Tp0453 six-histidine-tagged protein was purified by the metal-chelate affinity chromatography. The resulting homogenous recombinant T. pallidum Tp0453 protein was used to reveal specific IgG antibodies in the serum of syphilis patients using a microarray technology. Results and conclusion. The use of the resulting recombinant protein enabled authors to reveal anti- T. pallidum antibodies in the blood serum of patients suffering from syphilis (primary, secondary, early and late latent syphilis). None of the uninfected controls had a significant reactivity to the recombinant Tp0453. These data allow to propose, that the recombinant protein Tp0453 show promise for laboratory diagnosis of syphilis. The introduction of Tp0453 antigen into the test systems for diagnosis of syphilis (ELISA, immunoblotting or microarray) increases the potential of serodiagnosis of this disease due to the broader range of the revealed antitreponemal antibodies.

Full Text

Основным методом лабораторного исследования для выявления сифилиса является определение в крови пациентов антител к специфическим антигенам возбудителя заболевания Treponema pallidum [1—5]. В качестве наиболее специфических антигенов в составе диагностических тест-систем используются рекомбинантные аналоги антигенов Treponema pallidum: Tp15 (Tp0171), Tp17 (Tp0435), Tp47 (Tp0574), Tp44,5 (TmpA, Tp0768) [6, 7]. Тест-системы для серологических методов исследования на сифилис характеризуются высокими показателями чувствительности (97—99,7%), но не обладают 100% специфичностью. Диагностические свойства наборов реагентов для выявления сифилиса в значительной степени зависят от используемой производителями композиции антигенов T. pallidum, входящих в состав тест-системы. при этом показатели информативности иммунологических исследований существенно различаются при разных клинических формах заболевания, что может быть обусловлено уровнем экспрессии соответствующих антигенов T. pallidum и их доступности для иммунной системы больного [8]. В связи с этим актуальным представляется выявление, получение и изучение иммуногенности новых целевых антигенов T. pallidum, применение которых в диагностических тест-системах позволило бы повысить качество диагностики сифилиса. Антиген Tp0453 является гипотетическим белком наружной мембраны возбудителя сифилиса. На локализацию белка на внешней мембране T. pallidum указывают как результаты биоинформатических расчетов [7, 9], так и экспериментальные исследования по иммунизации лабораторных животных [9]. Результаты биоинформатического поиска, проведенного по базе данных белковых последовательностей NCBInr методами blastp и PSI-BLAST, показали, что белок Tp0453 специфичен для рода Treponema [7]. предполагается, что этот белок участвует в транспорте липидов и гликолипидов через внешнюю мембрану T. pallidum [10]. Таким образом, в связи с предполагаемой локализацией белка Tp0453 на наружной мембране микроорганизма, указаниями на его высокую иммуногенность и отсутствие гомологов среди бактерий других родов данный белок представляет значительный интерес как целевой антиген для серодиагностики сифилиса. Целью работы явилось получение рекомбинантного антигена T. pallidum Tp0453 и изучение клиниче ской эффективности его использования при диагностике сифилиса. Материал и методы В работе использовали клетки E. coli, штаммы BL21 (DE3) и Top10 (Invitrogen, США), плаз-мидный вектор для экспрессии pET28а (Novagen, США). Конъюгат козьих античеловеческих антител («Имтек», Россия) с флуорофором Cy5 был получен в соответствии с методикой производителя NHS-активированного флюоресцентного красителя (Biodye, Россия). Чистоту получаемых белков определяли электрофоретически в денатурирующих условиях с додецилсульфатом натрия в 12% полиакриламидном геле по U. Laemmli [11]. Концентрацию белка определяли по методу M. Bradford [12]. Для определения антигенных свойств рекомбинантного белка использовали образцы сыворотки крови больных с диагнозом «сифилис», поступившие в Лабораторный центр ФГБУ «ГНЦДК» Минздрава России. Биообразцы отбирали на основе результатов иммунохимических (серологических) исследований: реакции микропреципитации с кардиолипиновым антигеном, реакции быстрого плазмареагинового теста, реакции пассивной гемагглютинации, реакции непрямой иммунофлюоресценции (модификации РИФабс и РИФ200), иммуноферментного анализа, регламентированных действующими нормативными документами. Конструирование продуцента E. coli BL-21 (DE3) [pET28a-Tp0453]. Фрагмент гена tр0453, кодирующего последовательность белка Тр0453 без сигнального пептида, соответствующего аминокислотным остаткам 30—287, амплифицировали с помощью праймеров, сконструированных на основе последовательности гена tр0453 (GenBank NC_000919.1). Для амплификации были разработаны праймеры: 0453F_NdeI и 0453R_BamHIstop (см. таблицу), которые содержали на 5’-конце сайты распознавания эндонуклеаз рестрикции NdeI и BamHI соответственно (выделены полужирным шрифтом). Амплификация проводилась с использованием высокоточной полимеразы Pfu (Fermentas, Латвия) по следующей программе: 95 °С — 5 мин.; (95 °С — 30 с., 59 °С — 30 с., 72 °С — 5 мин.) 45 циклов; 72 °С — 7 мин. продукты полимеразной цепной реакции очищали от компонентов реакционной среды с помощью агарозного гель-электрофореза с последующим выделением целевого продукта с применением набора Wizard SV Gel and PCR Clean-Up System (Promega, США). Ампли-фицированные фрагменты гена tр0453 гидролизовали эндонуклеазами NdeI и BamHI в двукратном Tango буфере и лигировали с плазмидой pET28а (Novagen, США), предварительно обработанной теми же эндонуклеазами. после гидролиза фрагменты и вектор проходили очистку с применением того же набора реагентов и лигировались (лигаза Fermentas, Латвия). 76 k. № 6, 2013 I Таблица Олигонуклеотидные праймеры, использованные в работе Праймер Последовательность 5’-3’ 0453F_NdeI GTTCATATGGCATCAGTAGATCCGTTGGGG 0453R_BamHIstop TTTGGATCCTTACGAACTTCCCTTTTTGGAGTA Т7_F ATTAATACGACTCACTATAGGGGAATTG T7_R GTTATGCTAGTTATTGCTCAGCGGT Компетентные клетки E. coli штамма Т0Р10 трансформировали лигазной смесью и высевали на агари-зованную среду LB, содержащую 50 мкг/мл канамици-на. Наличие гена tp0453 в выросших на поверхности агаризованной среды трансформированных клетках подтверждали амплификацией сайтов встраивания вставки с использованием пар праймеров Т7_F/0453R_ BamHIstop и 0453F_NdeI/T7_R (см. таблицу). Схема экс-прессионного вектора, сконструированного на основе плазмиды pET28(+), приведена на рис. 1. Единичную колонию E. coli с подтвержденным (сек-венированием ДНК плазмиды) наличием целевого фрагмента гена tp0453 инокулировали в 5 мл среды LB, содержащей 50 мкг/мл канамицина, и культиви- Рис. 1. Схема экспрессионного вектора на основе плазмиды pET28(+) ровали при 37 °С и непрерывном перемешивании на шейкере в течение 12 ч. Из полученной биомассы плазмидную ДНК выделяли с использованием набора Plasmid Miniprep (Evrogen, Россия). Данный конструкт использовали для трансформации клеток штамма E. coli BL-21(DE3) (Novagen, США) с целью дальнейшей экспрессии целевого белка. Выделение и очистка рекомбинантного белка Tp0453. Продуцент E. coli BL-21 (DE3)-Tp0453 пересевали в 5 мл среды LB, содержавшей 50 мкг/мл канами-цина, и культивировали в течение 12 ч. На следующий день 5 мл 12-часовой культуры пересевали в 500 мл среды LB, содержавшей 50 мкг/мл канамицина. Культивирование проводили при 37 °С и непрерывном перемешивании в термостатируемом шейкере в течение 3 ч. до A600 » 0,8. Индукция биосинтеза рекомбинантного белка производилась добавлением изопропил-β-D-1-тиогалактопиранозида до конечной концентрации 1 мМ и дальнейшей инкубацией при 37 °С и непрерывном перемешивании на шейкере в течение 3 ч. Биомассу штамма-продуцента отделяли от культуральной жидкости центрифугированием при 3000 об/ мин в течение 20 мин. Супернатант сливали, осадки объединяли, ресуспендировали в малом объеме буфера и повторно центрифугировали при 3000 об/мин в течение 20 мин. Биомассу использовали немедленно для выделения суммарного белкового препарата или хранили до использования при -20 °С. Для разрушения клетки (2 г) ресуспендировали в четырехкратном объеме 50 мМ натрий-фосфатного буфера pH 7,4, содержавшего 0,5 M NaCl (буфер А) и ингибиторы протеолитических ферментов (Sigma, США). После этого добавляли лизоцим до конечной концентрации 1 мг/мл и инкубировали при комнатной температуре в течение 1 ч. Суспензию обрабатывали ультразвуком (5 х 1 мин.) на ультразвуковом дезинтеграторе УЗДН-А (Россия). Полученный гомогенат центрифугировали при 14 000 об/мин на центрифуге Hettich 24R в течение 30 мин. при 4 °С. Супернатант отбирали и фильтровали через насадки Millex с диаметром пор 0,22 мкм. Наличие целевого белка определяли с помощью денатурирующего полиакриламидного гель-электрофореза в 12% полиакриламидном геле. Вестник дерматологии и венерологии Научные исследования л 77 Очистку исследуемого рекомбинантного антигена возбудителя сифилиса проводили методом металл-хеллатной хроматографии. Для этого осветленную пробу наносили на хроматографическую колонку с 10 мл Ni-NTA-агарозы (GE Healthcare, США), уравновешенной с буфером А. промывали колонку этим буфером до Л280 = 0. Элюирование осуществляли линейным градиентом имидазола 0—400 мМ со скоростью 2 мл/ч в буфере А, объем фракций — 1 мл. Наличие целевого белка во фракциях элюата определяли с помощью денатурирующего электрофореза в 12% полиакриламидном геле. Фракции, которые содержали целевой белок, объединяли, диализо-вали против буфера А и концентрировали до объема 1 мл в ячейках для ультрафильтрации Amicon Ultra-4 Ultracel 10k с пределом исключения 10 кД. полученный раствор повторно очищали на колонке с Ni-NTA-агарозой. промывали колонку этим буфером до ^280 = 0. Элюирование связавшегося белка Tp0453 осуществляли линейным градиентом имидазола 0—400 мМ со скоростью 2 мл/ч в буфере А, объем фракций — 1 мл. Наличие целевого белка во фракциях элюата определяли с помощью денатурирующего электрофореза в 12% полиакриламидном геле. Фракции, в которых было подтверждено содержание целевого белка, вновь объединяли, диализовали против буфера 50 мМ натрий-фосфатного буфера pH 7,4 и концентрировали до объема 2 мл в ячейках для ультрафильтрации Amicon Ultra-4 Ultracel 10k с пределом исключения 10 кД. Исследование антигенных свойств рекомбинантного белка Tp0453. Микропечать биочипа. Для исследования антигенных свойств рекомбинантного белка м р м м м (і б;%1 so мі;· @ it/;· (і τ> г*т; (*ı) rir} iTnt ^ @ Si X -Jt:ii.X;I1K'I1XjI,s■ ■ 4łґX;-.X [M -.M1- M--M Tp0453 была применена методика исследования на иммунологическом биочипе (рис. 2). В качестве подложки было использовано микроскопное предметное стекло с поверхностью, модифицированной амино-силановыми группами (Corning, США). Нанесение всех компонентов на стекло производилось методом контактной микропечати с применением комплекс-принтера для микропечати BioOdyssey Calligrapher MiniArray (Bio-Rad, США). Биочип содержал 16 тестовых участков — эрреев для проведения одновременного исследования 16 биообразцов. Каждый эррей содержал иммобилизованные в определенном порядке антигены (рис. 2). помимо рекомбинантного белка Tp0453 в качестве компонентов эррея были использованы трепо-немные антигены Tp15, Tp17, Tp47, TmpA («Эколаб», Россия). Внутренним контролем служил человеческий IgG («Имтек», Россия). Кроме того, каждый эррей содержал отрицательный («холостой») контроль — участки с нанесенным фосфатно-солевым буфером и маркеры границы эррея — бычий сывороточный альбумин (БСА), конъюгированный с флуо-рофором Cy5. Маркеры границ эррея, отрицательные контроли и антигены Tp15, Tp17, Tp47, TmpA были нанесены на поверхности биочипа трехкратно, IgG — шестикратно, исследуемый рекомбинантный антиген Tp0453 — девятикратно. Исследование биообразцов. На биочип сверху помещали ограничительную рамку (whatman, США) так, чтобы каждый эррей полностью оказался в индивидуальной ячейке. поверхность биочипа блокировали раствором Na-фосфатного буфера pH 7,4, содержащим 1% БСА, 0,1% Tween-20, в течение 15 мин. при 37 °С. промы мм««··· WiIlMiI б а в Биочип для исследования иммуногенности белка Tp0453: а — схема расположения антигенов в индивидуальном эррее: М — маркеры границ эррея; p — отрица-Рис. 2. тельный контроль; 15, 17, 47, Titi — антигены T. pallidum tp15, Tp17, Tp47, TmpA; IgG — иммуноглобулин человека класса G; X — исследуемый антиген Tp0453; б — результаты исследования на эррее, инкубированном сывороткой, полученной от больного сифилисом; в — результаты исследования на эррее, инкубированном с сывороткой здоровых доноров 78 k. № 6, 2013 вали биочип 3 раза рабочим раствором для отмывки (Na-фосфатный буфер pH 7,4, содержащий 100 ммоль NaCl, 0,1% Tween-20), внося в каждую ячейку по 70 мкл раствора. Далее в каждую ячейку биочипа вносили по 60 мкл исследуемой сыворотки крови, разведенной в 100 раз в Na-фосфатном буфере pH 7,4, содержащем 0,1% БСА, 0,1% Tween-20. Ограничительную рамку на биочипе заклеивали пленкой и инкубировали в течение 30 мин. на термошейкере с вращением платформы 250 об/мин при 37 °С. После этого удаляли содержимое из ячеек и проводили их промывку. В каждую рабочую ячееку биочипа вносили по 60 мкл рабочего раствора конъюгата, заклеивали пленкой и инкубировали 30 мин. на термошейкере при 37 °С. Затем содержимое ячеек удаляли и проводили их промывку, снимали ограничительную рамку, биочип ополаскивали дистиллированной водой и высушивали центрифугированием при 2000 об/мин в течение 5 мин. Учет и интерпретация результатов образования комплексов антиген — антитело на биочипе. Детекция комплексов антиген — антитело на поверхности биочипа по окончании исследования образцов сыворотки крови осуществлялась на флюоресцентном сканере ChipReader Vers Array (Bio-Rad, США) при разрешении 10 мкм и длине волны эмиссии флюоресцентного красителя 670 нм. Обработку результатов серологического исследования на биочипе проводили с помощью программного обеспечения к сканеру, оценивая интенсивность флюоресценции участков нанесения соответствующих антигенов на поверхности биочипа и фонового сигнала поверхности эррея. В качестве сигнала фона принимали значение интенсивности флюоресценции в участках эррея, соответствующих участкам с нанесенным буфером для печати,- отрицательный контроль. Величина возбужденного флюоресцентного сигнала, полученная с участков нанесения специфического антигена, считалась значимой, а результат исследования положительным, свидетельствующим о присутствии в изучаемой сыворотке крови соответствующего антитела, если интенсивность флюоресценции превышала среднеквадратичное значение флуктуации интенсивности фонового сигнала. Если же интенсивность флюоресценции, измененная на участке эррея с нанесенным антигеном, не превышала среднеквадратичное значение фонового сигнала, то результат исследования оценивался как отрицательный, свидетельствующий об отсутствии антител к изучаемому антигену в тестируемом образце. проведенное иммунологическое исследование с биочипом считалось валидным при наличии положительного сигнала с участков внутреннего контроля, соответствующих иммобилизованным IgG. Результаты и обсуждение Для получения препаративного количества и дальнейшего изучения иммуногенности целевого белка была разработана технология получения рекомбинантного варианта белка Tp0453. В результате работы был получен гомогенный по данным денатурирующего электрофореза в полиакриламидном геле рекомбинантный вариант белка T. pallidum Tp0453 (рис. 3). Молекулярная масса выделенного рекомбинантного белка по данным электрофоретического анализа составляла около 30 кД, что хорошо согласуется с теоретической молекулярной массой, определенной для фрагмента белка без сигнального пептида (30,8 кД). Очищенный рекомбинантный белок T. pallidum Tp0453 был использован в качестве антигена для выявления специфических IgG в сыворотке больных сифилисом на иммунологическом биочипе. Для исследования антигенных свойств белка Tp0453 путем определения соответствующих антител к нему в крови больных сифилисом были использованы образцы сыворотки крови, полученные от больных с разными клиническими формами сифилиса: первичным (n = 16 образцов), вторичным (n = 16), скрытым ранним (n = 16) и поздним (n = 16). В качестве группы контроля прикД 150 100 75 50 37 25 Профиль белков на разных стадиях очистки рекомбинантного белка Tp0453: 1 — суммарный белковый препарат после разрушения неиндуцированных клеток Рис. 3. штамма-продуцента; 2 — суммарный белковый препарат после разрушения индуцированных клеток; 3 — хроматография на Ni-NTA-сефарозе; 4 — повторная хроматография на Ni-NTA-сефарозе; 5 — стандарты молекулярной массы белков 1 2 3 4 5 Вестник дерматологии и венерологии Научные исследования л 79 меняли сыворотку крови (n = 16), полученную от здоровых доноров, без указаний в анамнезе на заболевание сифилисом и с отрицательными результатами исследования в регламентированных серологических тестах на сифилис. предварительное исследование наличия специфических антител к белку Tp0453 показало, что полученный рекомбинантный белок специфически реагирует со всеми образцами сыворотки крови, полученными от больных сифилисом первичным, вторичным, скрытым ранним и поздним, что свидетельствовало о высокой чувствительности исследования. При изучении образцов сыворотки крови, полученных от здоровых доноров, антитела не были обнаружены, что характеризует исследование как обладающее высокой специфичностью. Заключение На основании приведенных данных можно сделать вывод о перспективности использования полученного рекомбинантного белка в качестве до полнительного антигена для иммуносерологических исследований, предназначенных для диагностики сифилиса. Включение нового антигена в состав иммуносорбентов в наборах реагентов для диагностики сифилиса (в формате иммуноферментного анализа, иммуно-блоттинга или иммуночипа) расширяет возможности серологической диагностики данного заболевания за счет увеличения спектра определяемых антител к T.pallidum. Особый интерес белок Tp0453 представляет для диагностики ранних форм сифилиса, что особенно актуально в свете развития реверсивных алгоритмов скрининга населения на сифилис. Для уточнения антигенных свойств целевого белка Tp0453 необходимо провести исследования на большем количестве образцов сыворотки крови больных сифилисом с учетом возможной иммунологической кросс-реактивности в случаях инфекционных заболеваний, вызванных боррелиями, лептоспирами и другими представителями рода спирохет.

About the authors

R F KHAIRULLIN

State Research Center of Dermatovenereology and Cosmetology, Ministry of Healthcare of the Russian Federation

Email: khairullin@cnikvi.ru

A V RUNINA

State Research Center of Dermatovenereology and Cosmetology, Ministry of Healthcare of the Russian Federation


K V ROG

State Research Center of Dermatovenereology and Cosmetology, Ministry of Healthcare of the Russian Federation


N V FRIGO

State Research Center of Dermatovenereology and Cosmetology, Ministry of Healthcare of the Russian Federation


S V ROTANOV

State Research Center of Dermatovenereology and Cosmetology, Ministry of Healthcare of the Russian Federation


References

  1. Черешнев В.А., Патрушева Н.Б., Бейкин Я.Б. и др. Сифилис: Иммунитет и лабораторная диагностика. Екатеринбург: УрО РАН; 2006
  2. Соколовский Е., Фриго Н., Ротанов С. Руководство по лабораторной диагностике сифилиса в странах Восточной Европы. Вестн дерматол и венерол 2008; (1): 87—96
  3. Овчинников Н.М., Беднова В.Н., Делекторский В.В. Лабораторная диагностика заболеваний, передающихся половым путем. М: Медицина; 1987
  4. Китаева Н.В., Фриго Н.В., Мелехина Л.Е. Актуальные проблемы сифилидологии. Современные технологии диагностики сифилитической инфекции. Вестн дерматол и венерол 2008; (5): 51—59
  5. Китаева Н.В., Фриго Н.В., Ротанов С.В., Хайруллин Р.Ф. Перспективы диагностического использования протеомных технологий в диагностике ИПППизаболеваний кожи. Вестн дерматол и венерол 2010; (4): 17—27
  6. Sambri V., Marangoni A., Simone M. et al. Evaluation of recomWell Treponema, a novel recombinant antigen-based enzyme-linked immunosorbent assay for the diagnosis of syphilis. Clin Microbiol Infect 2001; 7: 200—205
  7. Хайруллин Р.Ф., Ротанов С.В., Фриго Н.В., Белоусова А.В. Биоинформатический анализ специфических антигенов T. pallidum. Вестн дерматол и венерол 2012; (5): 56—64
  8. Carlson J.A., Dabiri G., Cribier B., Sell S. The im-munopathobiology of syphilis: the manifestations and course of syphilis are determined by the level of delayed-type hypersensitivity. Am J Dermatopathol 2011; 33: 433—460
  9. Cox D.L., Luthra A., Dunham-Ems S. et al. Surface immunolabeling and consensus computational framework to identify candidate rare outer membrane proteins of Treponema pallidum. Infect Immun 2010; 78: 5178—5194.
  10. Luthra A., Zhu G., Desrosiers D.C. et al. The transition from closed to open conformation of Treponema pallidum outer membrane-associated lipoprotein Tp0453 involves membrane sensing and integration by two amphipathic helices. J Biol Chem 2011; 286: 41656—41668.
  11. Laemmli U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 227: 680—685.
  12. Bradford M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976; 72: 248—254.

Statistics

Views

Abstract - 545

PDF (Russian) - 339

PlumX

Article Metrics

Metrics Loading ...

Dimensions

Refbacks

  • There are currently no refbacks.

Copyright (c) 2013 KHAIRULLIN R.F., RUNINA A.V., ROG K.V., FRIGO N.V., ROTANOV S.V.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies