Role of polymorphisms of PERP gene in the development of acantholysis in patients with pemphigus vulgaris

Abstract


Goal. To determine the nucleotide protein-coding PERP gene sequence and assess the relation between the revealed mutations/polymorphisms and development of true acantholytic pemphigus as well as particular features of its course. Materials and methods. The protein-coding PERP gene DNA sequence was studied by the sequence analysis method in 18 patients with true acantholytic pemphigus. Results. Two polymorphisms were discovered in patients with true acantholytic pemphigus in Exon 3 of the PERP gene for the first time: rs648802 (non-synonymous) and rs648396 (synonymous). The incidence of wild type genotypes in the revealed polymorphisms (С/С genotype rs648802 and Т/Т genotype rs648396) in healthy volunteers reliably exceeded that in patients (p = 0.049). Patients with true acantholytic pemphigus are characterized by a higher incidence rate of mutant heterozygous genotypes С/G rs648802 and Т/C rs648396 (p = 0.09). Mutant heterozygous genotypes of the polymorphisms (G/G genotype rs648802 and С/С genotype rs648396) were revealed in patients with the earlier onset of the disease (41-60 years) (p = 0.025) more often while heterozygous genotypes (С/G genotype rs648802 and T/С genotype rs648396) were revealed when the disease developed at the age of 61 or older more often (p = 0.01). Conclusion. Identification of the polymorphous genotype by the sequence method or other molecular methods (e.g. PCR) can be used to forecast the terms when true acantholytic pemphigus can emerge in genetically inclined patients. However, it should be noted that it is necessary to specify the preliminary results obtained based on a greater sample of patients with true acantholytic pemphigus.

Full Text

Ш Истинная акантолитическая пузырчатка - потенциально летальный дерматоз, ведущая роль в патогенезе которого в настоящее время отводится аутоиммунным реакциям, приводящим к акантолизу [1, 2]. Большое число работ посвящено исследованиям механизмов инициации аутоиммунных реакций, а также внутриклеточных процессов, приводящих к акантоли-зу [3, 4]. Несмотря на увеличение продолжительности жизни больных истинной акантолитической пузырчаткой после введения в схему лечения дерматоза глюкокортикостероидных препаратов, пациенты нередко умирают от осложнений иммуносупрессивной терапии. Данное обстоятельство вызывает необходимость исследования механизмов развития заболевания, в том числе на уровне генетического аппарата клетки, с целью выявления новых терапевтических мишеней. В настоящее время считается, что у пациентов, генетически предрасположенных к развитию истинной акантолитической пузырчатки, антигенпредставляю-щие (например дендритные) клетки, распознав компоненты десмосом как чужеродные, презентируют антиген Т-клеткам (Th0), инициируя их дифференцировку на Т-хелперные (Th) клетки 1-го и 2-го типов. В свою очередь, аутореактивные Т-клетки активируют синтез аутоантител В-клетками [1, 2]. Аутоантитела у больных истинной акантолитической пузырчаткой образуются не только к компонентам десмосом, но и к другим собственным антигенам эпидермиса. Именно аутоантителам приписывается основная патогенетическая роль в патогенезе истинной акантолитической пузырчатки. поэтому ряд исследований был направлен на изучение механизмов потери связи кератиноцитов друг с другом под действием аутоантител. Доказано, что, откладываясь в межклеточных пространствах эпидермиса, антитела инициируют передачу сигналов от мембранных рецепторов в цитоплазму и ядро кератиноцитов. это приводит к изменениям цитоскелета, погружению десмосом в цитоплазму с их последующим разрушением в лизосомах, активации каскада ферментов апоптоза, деградации и массивному коллапсу структурных белков, что завершается уменьшением объема клеток и, как следствие, разрывом оставшихся десмосом [2, 5, 6]. Именно активацией апоптотических сигнальных путей можно было бы отчасти объяснить морфологические изменения клеток эпидермиса при истинной акантолитической пузырчатке, а именно деградацию и массивный коллапс структурных белков с последующим уменьшением объема клеток. Однако программа апоптоза реализуется не полностью, и клетки не гибнут, а лишь претерпевают морфологические изменения, приводящие к формированию клеток Тцанка и клеток базального слоя. Исследование роли апоптоза в потере связи кератиноцитов друг с другом может способствовать созданию новых лекарственных препаратов, блокирующих акантолиз. В связи с этим особый интерес вызывает изучение трансмембранного белка PERP, участвующего в реализации апоптоза и регуляции ряда важнейших процессов в кератиноцитах, в том числе в обеспечении межклеточной адгезии. Белок PERP относится к семейству трансмембранных белков PMP-22/gas3, которые являются структурными компонентами миелина и одновременно - регуляторами клеточного роста. В коже человека белок PERP экспрессируется на поверхности кератиноцитов. Коллективу L. Attardi удалось продемонстрировать локализацию PERP в десмосомах и подтвердить участие этого белка в адгезии клеток [7, 8]. Кроме обеспечения межклеточной адгезии PERP также регулирует пролиферацию кератиноцитов [8, 9]. показано, что апоптоз сопровождается экспрессией белка PERP. Возможно, существуют два механизма PERP-зависимого апоптоза. Во-первых, его сходство с у-субъединицей кальциевых каналов предполагает наличие порообразующей или каналобразующей активности, способствующей выходу из цитоплазматических хранилищ молекул, необходимых для индукции апоптоза. Во-вторых, не исключено, что PERP, аналогично белкам KILLER/DR5 и FAS/APO-1/CD95, является «рецептором смерти», принимающим аутокринные или паракринные сигналы [8, 10]. Ген PERP, кодирующий мембранный белок PERP, необходимый для реализации функций десмосом в коже и слизистых оболочках, был открыт в 2000 г., когда L. Attardi и соавт. обнаружили его активацию в процессе апоптоза, индуцируемую непосредственно р53 [8]. Ген PERP находится на 6-й хромосоме, содержит 19 032 пары оснований (п. о.) и включает 3 экзона, кодирующих белковую цепь PERP длиной в 193 аминокислоты. первый экзон гена PERP содержит 397 п. о., второй - 140 п. о. и третий - 3764 п. о.; общая длина белоккодирующей последовательности гена PERP составляет 579 п. о. Отмечено наличие взаимосвязи между отсутствием гена PERP и нарушением межклеточной адгезии кератиноцитов [8, 10-13]. L. Attardi и соавт. в эксперименте показано, что PERP'1- мыши погибали вскоре после рождения в результате формирования внутриэпи-дермальных пузырей на коже и слизистых оболочках. Число десмосом у PERP-/- мышей было снижено, также обнаруживалось нарушение их связи с цитоскелетом клетки [8]. Исследование кератиноцитов у мышей, лишенных белка PERP, показывает различные изменения десмосом на субклеточном уровне: происходит смещение белков десмоглеина 3, плакоглобина, нарушается нормальная структура десмосом, изменяется последовательность белков, входящих в ее состав, на-блюдется агрегация десмоплакина в цитоплазме. Кроме того, отмечается изменение электрического заря 72 к. № 5, 2013 да клеточной мембраны, нарушается механическое и биохимическое взаимодействие между клетками [14]. B. Nguyen и соавт. продемонстрировали, что под действием аутоагрессивных IgG десмоглеин 3 и PERP отделяются от цитоплазматической мембраны кера-тиноцитов человека и вместе со структурным белком десмосом плакоглобином погружаются в цитоплазму, где подвергаются разрушению в лизосомах [15]. Полученные данные указывают на возможное участие белка PERP в акантолизе. Принимая во внимание данные о реактивации гена PERP белком р53 в процессе апоптоза и о непосредственном участии в его реализации, а также сведения об активации сигнальных путей апоптоза в процессе акантолиза при истинной акантолитической пузырчатке [3, 8, 11, 12, 14, 16-19], изучение гена PERP при истинной акантолитической пузырчатке представляет значительный интерес. Представляется целесообразным изучение белоккодирующей последовательности гена PERP у больных истинной акантолитической пузырчаткой с целью выявления полиморфизмов/мутаций, возможно, ассоциированных с развитием данного заболевания и/или особенностями его клинического течения. Цель исследования: определение нуклеотидной белоккодирующей последовательности гена PERP с оценкой взаимосвязи между выявленными мутациями/полиморфизмами и развитием истинной акантолитической пузырчатки, особенностями ее течения. Материал и методы Под наблюдением находились 18 больных истинной акантолитической пузырчаткой (основная группа) и 16 здоровых добровольцев (контрольная группа). Пациентов включали в исследование согласно следующим критериям включения: подписание информированного согласия на участие в исследовании; наличие у больного истинной акантолитической пузырчатки; возраст пациента не менее 18 лет. Критерием исключения служило наличие тяжелого соматического заболевания в стадии декомпенсации. Критерием включения здоровых добровольцев в исследование служили: возраст не менее 18 лет, отсутствие заболеваний кожи на момент обследования и в течение 1 мес. до включения в исследование. Набор больных и здоровых добровольцев в исследование осуществлялся на базе ФГБУ «Государственный научный центр дерматовенерологии и косметологии» Минздрава России. Диагноз истинной акантолитической пузырчатки устанавливался на основании данных клинической картины, результатов цитологического (наличие в мазках-отпечатках акантолитических клеток) и гистологического исследований, реакции прямой иммунофлюоресценции (учет результатов проводили с использованием конфокального лазерного сканирую щего микроскопа). Для проведения гистологического исследования у больных истинной акантолитической пузырчаткой биоптаты кожи получали из очагов поражения; для выявления отложения IgG в межклеточных пространствах эпидермиса при помощи иммунофлюо-ресцентного исследования биоптаты кожи получали в области видимо не пораженной кожи (вблизи очагов поражения). С целью изучения молекулярной структуры гена PERP использовали образцы венозной крови (в количестве 4 мл), полученные от больных истинной акан-толитической пузырчаткой и здоровых добровольцев, которые помещали в вакуумные системы типа Vacuette с фиолетовой крышкой, содержащие антикоагулянты (К2-ЭДТА или К3-ЭДТА), не ингибирующие ПЦР. Полученные образцы до проведения исследования сохраняли в низкотемпературном холодильнике при температуре не выше -20 °С. Исследование молекулярной структуры белоккодирующей последовательности гена PERP человека проводилось в несколько этапов. 1. Выделение ДНК из образцов крови, полученных от пациентов с истинной акантолитической пузырчаткой и здоровых добровольцев. 2. Амплификация белоккодирующей последовательности ДНК трех экзонов гена PERP и визуализация продуктов амплификации. 3. Проведение сиквенсной реакции и капиллярного электрофореза на генетическом анализаторе. 4. Анализ полученных данных. Выделение ДНК из образцов крови проводили с помощью набора реагентов GeneJET (фирма Fermentas, Литва) в соответствии с инструкцией производителя. Нуклеотидная последовательность гена PERP была найдена в базе данных GenBank под номером ID: 64065. Праймеры для полимеразной цепной реакции подбирались с помощью программы Oligo6. Для проведения ПЦР использовали набор с HS Taq ДНК-полимеразой (фирма «Евроген», Россия) в соответствии с инструкцией производителя. Характеристика праймеров, ПЦР-продуктов, а также условия проведения амплификации трех экзонов гена PERP представлены в табл. 1. Для амплификации 2-го экзона гена PERP использовали подход Touchdown («ступенчатая ПЦР») с каскадным понижением температуры на этапах отжига праймеров. Применение варианта ПЦР Touchdown позволило снизить количество неспецифического продукта в реакции. Электрофоретическое разделение продуктов ПЦР проводили в 2% агарозном геле. Результаты реакций амплификации оценивали с помощью трансиллюминатора с фотокамерой для фотографирования гелей в ультрафиолетовом свете с длиной волны 310 нм. Полученные ПЦР-продукты осаждали с помощью ферментов: EcoI (Fermentas, Литва) и щелочная фос- Вестник дерматологии и венерологии Научные исследования л 73 Табл а 1 Последовательности праймеров для амплификации белоккодирующей последовательности ДНК иц трех экзонов гена PERP. Условия проведения амплификации, размер ПЦР-продуктов Экзон Праймеры Условия амплификации Размер ПЦР-продуктов 1-й Perp1ex for CT CTGAGT CACCGGAAT CTAG 95 °С - 3 мин.; 609 п.о. Perp1ex rev TT CTGTTT CTGAGCTTGGTGTT 35 циклов: 95 °С - 10 сек.; 62 °С - 10 сек.; 72 °С - 25 сек.; 72 °С - 3 мин. 2-й Perp2ex rev T CCGAGAACAGATTAGAAACTG Perp2ex for CCTTAAAATATGGAGATGCTCAA 95 °C - 3 мин. 5 циклов: 95 °С - 10 сек. 68 °С - 10 сек. 72 °С - 25 сек. 5 циклов: 95 °С - 10 сек. 64 °С - 10 сек. 72 °С - 25 сек. 25 циклов: 95 °С - 10 сек. 62 °С - 10 сек. 72 °С - 25 сек. 72 °С - 3 мин. 419 п.о. 3-й Perp3ex for GCAGAAACTTGGTGGAAGGA 95 °C - 3 мин.; 406 п.о. Perp3ex rev GTTCAAAGTCGCCTGGAGAA 35 циклов: 95 °С - 10 сек.; 62 °С - 10 сек.; 72 °С - 25 сек.; 72 °С - 3 мин. фатаза SAP (Fermentas, Литва). В реакции использовали 0,5 мкл экзонуклеазы (20 ед. в мкл), 1 мкл фос-фатазы (1 ед. в мкл) и 5 мкл пЦР-продукта. Реакцию осаждения пЦР-продуктов проводили при следующих условиях: 1) 37 °С - 30 мин., 2) 90 °С - 20 мин. продукты реакции осаждения использовали при постановке сиквенсной реакции. проведение сиквенсной реакции осуществляли с использованием набора реагентов для секвенирова-ния ДНК Big Dye Terminator v3.1 Sequencing RR-100 (фирма Applied Biosystems, США) в соответствии с инструкцией производителя. В качестве праймеров для сиквенсной реакции использовали праймеры, представленные в табл. 1. продукты сиквенсной реакции осаждали спиртом, после чего проводили их электрофоретическое разделение с использованием генетического анализатора 3130 Genetic Analyzer (фирма Applied Biosystems, США). Анализ нуклеотидных последовательностей экзонов гена PERP, полученных в результате секве-нирования, проводили с использованием программы MEGA5 и пакета программ BLAST (http://www.ncbi.nlm. nih.gov/BLAST/). Результаты проведенных исследований оценивались путем статистической обработки: частота встречаемости аллелей гена PERP определялась путем прямого расчета. Достоверность различий между ча стотами встречаемости признаков в двух сравниваемых группах обследованных (больных пузырчаткой и здоровых) оценивалась с применением четырехпольной таблицы, критерия х2и показателя отношения шансов (Odds Ratio - OR), рассчитываемых при помощи калькулятора, находящегося в открытом доступе на сайте библиотеки Meta Numerics (http://www. meta-numerics.net/Samples/ContingencyCalculator. aspx). Результаты исследований Клиническая характеристика выборки В обследуемую выборку были включены 18 больных с подтвержденным диагнозом истинной акантолитической пузырчатки, в том числе 2 (11,1%) женщины и 16 (88,9%) мужчин. Возраст больных истинной акан-толитической пузырчаткой составлял от 18 до 76 лет (в среднем 54,22 ± 17,6 года). Следует отметить, что 1 (50%) женщина и 13 (81,3%) мужчин заболели в трудоспособном возрасте. Среди больных истинной акантолитической пузырчаткой у 11 (61,1%) была вульгарная пузырчатка, у 7 (38,9%) - себорейная. Из 18 больных с дебютом заболевания были госпитализированы 7 (38,9%) пациентов, с рецидивом заболевания - 11 (61,1%). Возраст больных при дебюте истинной акантолитической пузырчатки варьировал от 17 до 75 лет (в сред 74 к. № 5, 2013 Рисунок Вульгарная пузырчатка у больной Г. с преимущественным поражением красной каймы губ (а) и слизистой оболочки полости рта (б) нем 51,9 ± 17,3 года). Длительность заболевания составляла от 1 до 125 мес. (в среднем 27,2 мес.). После появления первых признаков заболевания диагноз истинной акантолитической пузырчатки был установлен в сроки от 1 мес. до 4,5 лет, в среднем через 18,8 ± 16,96 мес. У большинства больных патологический процесс локализовался на коже (n = 6; 33,3%) с одновременным вовлечением слизистых оболочек у 10 (55,6%) больных истинной акантолитической пузырчаткой. У 2 (11,1%) больных отмечалось поражение только слизистой оболочки полости рта без клинических проявлений на коже. После дебюта заболевания высыпания носили ограниченный характер и локализовались только на слизистых оболочках полости рта или только на коже туловища или волосистой части головы (рис.). Через 1 месяц - 4 года высыпания у пациентов принимали распространенный характер. Площадь поражения кожных покровов при этом составляла от 1 до 18% (в среднем - 5,11%). При обследовании больных выявлена ассоциация истинной акантолитической пузырчатки с другими аутоиммунными заболеваниями, в частности аутоиммунный тиреоидит отмечен у 6 (33,3%) больных, ревматоидный артрит - у 1 (5,6%). У 14 больных (77,8%) истинная акантолитическая пузырчатка протекала на фоне патологии сердечно-сосудистой системы (гипертоническая болезнь, ишемическая болезнь сердца), у 15 (83,3%) - сочеталась с заболеваниями желудочно-кишечного тракта (хронический холецистит, панкреатит, гастрит, дуоденит). Все обследованные пациенты получали лечение глюкокортикостероидными препаратами, длительность терапии составляла от 1 до 37 месяцев. Следует отметить, что у 13 (72,2%) больных регистрировались осложнения глюкокортикостероидной терапии: сахарный диабет (n = 4; 22,2%), надпочечниковая недостаточность (n = 3; 16,7%), нарушение толерантности к глюкозе (n = 8; 44,4%), артериальная гипертензия (n = 8; 44,4%). При этом сроки развития осложнений составляли от 1 до 11 месяцев от начала системной терапии глюкокортикостероидными препаратами (в среднем 6 мес.). Контрольную группу составили 16 здоровых добровольцев: 4 женщины (25%) и 12 мужчин (75%). Обследованные группы были сопоставимы по полу и возрасту. Результаты изучения белоккодирующей последовательности гена PERP методом секвенирования В результате анализа белоккодирующей нуклеотидной последовательности гена PERP у больных истинной акантолитической пузырчаткой и здоровых добровольцев в 1-м и 2-м экзонах мутаций/полиморфизмов обнаружено не было, в третьем экзоне гена PERP были обнаружены два SNP1. В базе данных NCBI выявленные SNP описаны и обозначаются как rs648802 (C611G) и rs648396 (T675C). Данные SNP являются полиморфизмами, поскольку встречаются в популяции с частотой более чем 1%. В случае полиморфизма rs648802 происходит замена нуклеотида С (цитозина) 1 Single nucleotide polymorphism, SNP - однонуклеотидный полиморфизм - отличия последовательности ДНК размером в один нуклеотид (A, T G или C) в геноме (или в другой сравниваемой последовательности). Вестник дерматологии и венерологии Научные исследования л 75 Таблица 2 Результаты секвенирования белоккодирующих последовательностей экзонов гена PERP у больных акантолитической пузырчаткой и здоровых добровольцев Больные истинной акантолитической пузырчаткой, № п/п Определяемые генотипы Здоровые, № п/п Определяемые генотипы rs648802 (полиморфизм C/G в положении 611 3-го экзона гена PERP) rs648396 (полиморфизм T/C в положении 675 3-го экзона гена PERP) rs648802 (полиморфизм C/G в положении 611 3-го экзона гена PERP) rs648396 (полиморфизм T/C в положении 675 3-го экзона гена PERP) 1 GG CC 1 CG TC 2 CG TC 2 CC TT 3 CG TC 3 CC TT 4 cc TT 4 GG CC 5 GG CC 5 GG CC 6 CG TC 6 GG CC 7 GG CC 7 CG TC 8 CG TC 8 CG TC 9 CG TC 9 CG TC 10 CG TC 10 CC TT 11 CG TC 11 GG CC 12 CG TC 12 CC TT 13 GG CC 13 CC TT 14 CG TC 14 GG CC 15 GG CC 15 CG TC 16 CG TC 16 GG CC 17 GG CC 18 GG CC на G (гуанин) в положении 611 нуклеотидной цепи, что приводит к замене пролина на аргинин в положении 143 белковой цепи PERP. Результаты изучения генотипов PERP больных акантолитической пузырчаткой и здоровых добровольцев представлены в табл. 2. У здоровых добровольцев частота выявления С/G генотипа rs648802 в 3-м экзоне гена PERP составила 31,3% (у 5 из 16), частота генотипа G/G rs648802 составила 37,4% (у 6 из 16), частота генотипа С/С rs648802 определялась в 31,3% случаев (у 5 из 16). Частота выявления Т/С генотипа rs648396 в 3-м экзоне гена PERP составила 31,3% (у 5 из 16), частота генотипа С/С rs648396 составила 37,4% (у 6 из 16), частота генотипа Т/Т rs648396 определялась в 31,3% случаев (у 5 из 16). У больных истинной акантолитической пузырчаткой частота выявления С/G генотипа rs648802 в 3-м экзоне гена PERP составила 55,5% (у 10 из 18), частота генотипа G/G rs648802 составила 38,9% (у 7 из 18), частота генотипа С/С rs648802 определялась в 5,6% случаев (у 1 из 18). Частота выявления Т/С генотипа rs648396 гена PERP составила 55,5% (у 10 из 18), частота генотипа С/С rs648396 составила 38,9% (у 7 из 18), частота генотипа Т/Т определялась в 5,6% случаев (у 1 из 18). По данным секвенирования изучаемые полиморфизмы rs648802 и rs648396 наследуются сцеплен-но: G(rs648802) с C(rs648396), а также C(rs648802) с T(rs648396). Проведено сравнение частоты встречаемости генотипов у больных истинной акантолитической пузырчаткой и здоровых добровольцев. Несмотря на небольшой размер выборки сравниваемых групп больных истинной акантолитической пузырчаткой и здоровых добровольцев, частота встречаемости гомозиготных генотипов «дикого» типа выявленных полиморфизмов (С/С генотип rs648802 и Т/Т генотип rs648396) у здоровых добровольцев достоверно превысила частоту встречаемости данных генотипов у больных (при расчете данных с применением четырехпольной таблицы и критерия х2 получены значения: х2 = 3,85; p = 0,049, 76 к. № 5, 2013 Odds Ratio = 0,13; a = 0,15; С195% = 0,17; 0,42). Вместе с тем у больных истинной акантолитической пузырчаткой отмечена тенденция к более частому выявлению мутантных гетерозиготных генотипов С/G rs648802 и Т/C rs648396 (при расчете данных с применением четырехпольной таблицы и критерия х2 получены значения: х2 = 2,86; p = 0,09, Odds Ratio = 3,25; a = 2,30; С195% = -1,26; 7,76,). при сравнении частот встречаемости генотипов у больных различными формами пузырчатки (вульгарной и себорейной) у мужчин и женщин, а также у больных с манифестацией высыпаний на слизистых оболочках и больных с манифестацией заболевания на коже, у больных с поражением только слизистых оболочек, только кожных покровов или сочетанным поражением слизистых оболочек и кожных покровов статистически значимых различий обнаружено не было. при сравнении частот встречаемости генотипов у больных в зависимости от возраста, в котором возникли первые высыпания, было выявлено, что гомозиготные мутантные генотипы выявленных полиморфизмов (G/G генотип rs648802 и С/С генотип rs648396) чаще выявлялись у больных с более ранним началом заболевания (41-60 лет) (х2 = 5; p = 0,025), а гетерозиготные генотипы (С/G генотип rs648802 и T/С генотип rs648396) - при манифестации заболевания в возрасте 61 года и старше (х2 = 6,6; p = 0,01). Заключение Таким образом, в результате анализа белоккоди-рующей нуклеотидной последовательности гена PERP впервые на российской выборке больных истинной акантолитической пузырчаткой и здоровых добровольцев в третьем экзоне гена PERP были выявлены два полиморфизма: rs648802 (несинонимичная замена нуклеотида, то есть приводящая к замене аминокислоты в кодируемом белке) и rs648396 (синонимичная замена нуклеотида, не приводящая к замене аминокислоты в белковой цепи). Наблюдаемая нуклеотидная замена (rs648802) является значимой, так как приводит к изменению аминокислотной последовательности белка PERP и, следовательно, к изменению его структуры и, возможно, функции. Биологическое значение полиморфизма rs648802 в гене PERP, приводящего к замене аминокислоты в белке PERP, может заключаться в том, что наличие G-аллеля в rs648802 сопровождается усилением функции белка PERP, и, следовательно - активацией процессов апоптоза [20]. при истинной акантолитической пузырчатке показана активация апоптотических сигнальных путей в эпидермисе в процессе акантолиза [21]. поэтому если наличие G-аллеля в положении 611 третьего эк-зона гена PERP связано с усилением функции белка PERP, то у носителей полиморфного гена PERP может усугубляться поражение кожи и/или слизистых оболочек. Это предположение косвенно подтверждается результатами настоящего исследования, показавшими более высокую частоту встречаемости генотипа «дикого» типа у здоровых добровольцев по сравнению с больными истинной акантолитической пузырчаткой, тенденцию к более частому выявлению мутантных гетерозиготных генотипов С/G rs648802 и Т/C rs648396 у больных истинной акантолитической пузырчаткой, более раннюю манифестацию заболевания у носителей гомозиготного полиморфного генотипа (G/G генотип rs648802 и С/С генотип rs648396) и более позднее начало пузырчатки у носителей гетерозиготного полиморфного генотипа (С/G генотип rs648802 и T/С генотип rs648396). Идентификация полиморфного генотипа в третьем экзоне гена PERP методом секвенирования или другими молекулярными методами (например пЦР-пФРФ) может быть использована с целью прогнозирования сроков манифестации истинной акантолитической пузырчатки у генетически предрасположенных пациентов. Однако следует подчеркнуть необходимость уточнения полученных предварительных результатов на более крупной выборке больных истинной аканто-литической пузырчаткой и здоровых добровольцев.

About the authors

A A KUBANOV

State Research Center of Dermatovenereology and Cosmetology Ministry of Healthcare of the Russian Federation; Russian Medical Academy of Postgraduate Studies, Ministry of Health of the Russian Federation


A V MICHENKO

State Research Center of Dermatovenereology and Cosmetology Ministry of Healthcare of the Russian Federation


T V ABRAMOVA

Russian Medical Academy of Postgraduate Studies, Ministry of Health of the Russian Federation

Email: abtava@mail.ru

O S KOZHUSHNAYA

State Research Center of Dermatovenereology and Cosmetology Ministry of Healthcare of the Russian Federation


N V FRIGO

State Research Center of Dermatovenereology and Cosmetology Ministry of Healthcare of the Russian Federation; Russian Medical Academy of Postgraduate Studies, Ministry of Health of the Russian Federation


L F ZNAMENSKAYA

State Research Center of Dermatovenereology and Cosmetology Ministry of Healthcare of the Russian Federation


References

  1. Samcov A.V., Belousova I.Je. Bulleznye dermatozy: Monografija. SPb: OOO «Kosta» 2012;144. [Самцов А.В., Белоусова И.Э. Буллезные дерматозы: Монография. СПб: ООО «Коста» 2012; 144.]
  2. Grando S.A. Pemphigus autoimmunity: hypotheses and realities. Autoimmunity 2012; 45: 1: 7-35.
  3. Grando S.A., Bystryn J., Chernyavsky A.I. Apoptolysis: a novel mechanism of skin blistering in pemphigus vulgaris linking the apoptotic pathways to basal cell shrinkage and suprabasal acantholysis. Exp Dermatol 2009; 18: 764-770.
  4. Schmidt E., Zillikens D. The diagnosis and treatment of autoimmune blistering skin diseases. Dtsch Arztebl Int 2011; 108: 399-405.
  5. Green K.J., Simpson C.L. Desmosomes: new perspectives on a classic. J Invest Dermatol 2007; 127: 2499-2515.
  6. Kalantari-Dehaghi M., Anhalt G., Camilleri M. et al. Pemphigus vulgaris antibodies target PERP and several other keratinocyte membrane and mitochondrial proteins. J Invest Dermatol 2011; 131: 1: 11-16.
  7. Kalantari-Dehaghi M., Molina D.M., Farhadieh M. et al. New targets of Pemphigus vulgaris antibodies identified by protein array technology. Exp Dermatol 2011; 20: 154-156.
  8. Attardi L.D., Reczek E.E. Cosmas C. et al. PERP, an apoptosis-associated target of p53, is a novel member of the PMP-22/gas3 family. Genes Dev 2000; 14 (6): 704-718.
  9. Jheon A.H., Mostowfi P., Snead M.L. et al. PERP regulates enamel formation via effects on cell-cell adhesion and gene expression. J Cell Sci 2011; 124 (Pt 5): 745-754.
  10. Ihrie R.A., Reczek E., Horner J.S. at al. Perp is a Mediator of p53-Dependent Apoptosis in Diverse Cell Types. Current Biology 2003; 13 (22): 1985-1990.
  11. Ihrie R.A., Marques M.R., Nguyen B.T. et al. Perp is a p63-regulated gene essential for epithelial integrity. Cell 2005; 120: 843-856.
  12. Marques M.R., Ihrie R.A., Horner J.S., Attardi L.D. The requirement for perp in postnatal viability and epithelial integrity reflects an intrinsic role in stratified epithelia. J Invest Dermatol 2006; 126: 69-73.
  13. Johnson T.M., Meade K., Pathak N., Marques M.R., Attardi L.D. Knockin Mice Expressing a Chimeric p53 Protein Reveal Mechanistic Differences in How p53 Triggers Apoptosis and Senescence. Proc Natl Acad Sci uSa 2008; 105 (4): 1215-1221.
  14. Reaz S., Mossalam M., Okal A., Lim C.S. A single mutant, A276S of p53, turns the switch to apoptosis. Mol Pharm 2013; 10 (4): 1350-1359.
  15. Nguyen B., Dusek R.L., Beaudry V.G. et al. Loss of the desmosomal protein Perp enhances the phenotypic effects of pemphigus vulgaris autoantibodies. J Invest Dermatol 2009; 129: 1710-1718.
  16. Arredondo J., Chernyavsky A.I., Karaouni A., Grando SA. Novel mechanisms of target cell death and survival and of therapeutic action of IVIg in Pemphigus. Am J Pathol 2005; 167: 1531-1544.
  17. Deb-Basu D., Aleem E., Kaldis P., Felsher D.W. CDK2 is required by MYC to induce apoptosis. Cell Cycle 2006; 5: 1342-1347.
  18. Lanza A., Cirillo N., Rossiello R. et al. Evidence of key role of Cdk2 overexpression in Pemphigus vulgaris. J Biol Chem 2008; 283: 8736-8745.
  19. Dusek R.L., Bascom J.L., Vogel H. et al. Deficiency of the p53/p63 Target Perp Alters Mammary Gland Homeostasis and Promotes Cancer. Breast Cancer Res 2012; 14 (2): 65.
  20. Flachsbart F., Franke A., Kleindorp R. et al. Investigation of genetic susceptibility factors for human longevity - a targeted nonsynonymous SNP study. Mutat Res 2010; 694 (1-2): 13-19.
  21. Lotti R., Marconi A., Pincelli C. Apoptotic pathways in the pathogenesis of pemphigus: targets for new therapies. Curr Pharm Biotechnol. 2012; 13 (10): 1877-1881.

Statistics

Views

Abstract - 572

PDF (Russian) - 270

PlumX

Article Metrics

Metrics Loading ...

Dimensions

Refbacks

  • There are currently no refbacks.

Copyright (c) 2013 KUBANOV A.A., MICHENKO A.V., ABRAMOVA T.V., KOZHUSHNAYA O.S., FRIGO N.V., ZNAMENSKAYA L.F.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies